Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633070_at:

>probe:Drosophila_2:1633070_at:598:123; Interrogation_Position=460; Antisense; ACCCTTAGGGCACTGGTTGAAAGAG
>probe:Drosophila_2:1633070_at:550:117; Interrogation_Position=486; Antisense; AGCTCGGAGTGCTGGGACCCACAAT
>probe:Drosophila_2:1633070_at:460:527; Interrogation_Position=499; Antisense; GGGACCCACAATCCGGATGTTCTTA
>probe:Drosophila_2:1633070_at:277:173; Interrogation_Position=577; Antisense; AAAGAACTGAAGGTCCGCGCTTCGC
>probe:Drosophila_2:1633070_at:112:323; Interrogation_Position=593; Antisense; GCGCTTCGCAGCAGTTTCAACTTGC
>probe:Drosophila_2:1633070_at:356:191; Interrogation_Position=611; Antisense; AACTTGCGCTGAATTTGATTGATGA
>probe:Drosophila_2:1633070_at:230:339; Interrogation_Position=654; Antisense; GCTAATTTTTATGGCCACCTTGGCG
>probe:Drosophila_2:1633070_at:574:259; Interrogation_Position=669; Antisense; CACCTTGGCGTACGTGGTCTATATC
>probe:Drosophila_2:1633070_at:380:519; Interrogation_Position=682; Antisense; GTGGTCTATATCCTGTGCTACGATA
>probe:Drosophila_2:1633070_at:703:375; Interrogation_Position=724; Antisense; GAAGAAGGCCGCTATCTGGAAAAAA
>probe:Drosophila_2:1633070_at:550:231; Interrogation_Position=747; Antisense; AATGAAAACCTCTAGACTGCCGATG
>probe:Drosophila_2:1633070_at:520:405; Interrogation_Position=761; Antisense; GACTGCCGATGAAGGGTTACTACTA
>probe:Drosophila_2:1633070_at:318:541; Interrogation_Position=775; Antisense; GGTTACTACTATTTGATGCGTCTGC
>probe:Drosophila_2:1633070_at:514:51; Interrogation_Position=790; Antisense; ATGCGTCTGCTCAGAGCGCCCATAT

Paste this into a BLAST search page for me
ACCCTTAGGGCACTGGTTGAAAGAGAGCTCGGAGTGCTGGGACCCACAATGGGACCCACAATCCGGATGTTCTTAAAAGAACTGAAGGTCCGCGCTTCGCGCGCTTCGCAGCAGTTTCAACTTGCAACTTGCGCTGAATTTGATTGATGAGCTAATTTTTATGGCCACCTTGGCGCACCTTGGCGTACGTGGTCTATATCGTGGTCTATATCCTGTGCTACGATAGAAGAAGGCCGCTATCTGGAAAAAAAATGAAAACCTCTAGACTGCCGATGGACTGCCGATGAAGGGTTACTACTAGGTTACTACTATTTGATGCGTCTGCATGCGTCTGCTCAGAGCGCCCATAT

Full Affymetrix probeset data:

Annotations for 1633070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime