FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633076_at:

>probe:Drosophila_2:1633076_at:439:589; Interrogation_Position=1027; Antisense; TGGATGAGGTTGTCAGCCAGCCCAA
>probe:Drosophila_2:1633076_at:40:497; Interrogation_Position=1038; Antisense; GTCAGCCAGCCCAAGCAGAAGTCAG
>probe:Drosophila_2:1633076_at:312:699; Interrogation_Position=1197; Antisense; TTATTAAGACTCTCGTGCGTAGCCC
>probe:Drosophila_2:1633076_at:188:497; Interrogation_Position=1227; Antisense; GTCTAGGTTAACTCCAAGTATCGAT
>probe:Drosophila_2:1633076_at:497:415; Interrogation_Position=736; Antisense; GAGCCATGTGCCGTCCAGGAGTTCA
>probe:Drosophila_2:1633076_at:222:87; Interrogation_Position=774; Antisense; AGTCGCCGGGTGTTTGTCCGCCATT
>probe:Drosophila_2:1633076_at:332:503; Interrogation_Position=789; Antisense; GTCCGCCATTCGGAGCAGGGTTTAA
>probe:Drosophila_2:1633076_at:101:243; Interrogation_Position=816; Antisense; AATTTCGTAGTTAAGCGCCCTCGAG
>probe:Drosophila_2:1633076_at:427:549; Interrogation_Position=842; Antisense; GGAGGACTGCAATGCCGATGCCGAC
>probe:Drosophila_2:1633076_at:506:609; Interrogation_Position=868; Antisense; TGACCATCGACCAAATGCTGGCCAA
>probe:Drosophila_2:1633076_at:445:311; Interrogation_Position=888; Antisense; GCCAAGTATGCCAACGAGAATTCCG
>probe:Drosophila_2:1633076_at:362:363; Interrogation_Position=905; Antisense; GAATTCCGAAGATGACTCCGACTTT
>probe:Drosophila_2:1633076_at:613:145; Interrogation_Position=919; Antisense; ACTCCGACTTTGTGCCCAATGAGGA
>probe:Drosophila_2:1633076_at:727:365; Interrogation_Position=990; Antisense; GAATCCGGCTCCAGCGAAGGAATAA

Paste this into a BLAST search page for me
TGGATGAGGTTGTCAGCCAGCCCAAGTCAGCCAGCCCAAGCAGAAGTCAGTTATTAAGACTCTCGTGCGTAGCCCGTCTAGGTTAACTCCAAGTATCGATGAGCCATGTGCCGTCCAGGAGTTCAAGTCGCCGGGTGTTTGTCCGCCATTGTCCGCCATTCGGAGCAGGGTTTAAAATTTCGTAGTTAAGCGCCCTCGAGGGAGGACTGCAATGCCGATGCCGACTGACCATCGACCAAATGCTGGCCAAGCCAAGTATGCCAACGAGAATTCCGGAATTCCGAAGATGACTCCGACTTTACTCCGACTTTGTGCCCAATGAGGAGAATCCGGCTCCAGCGAAGGAATAA

Full Affymetrix probeset data:

Annotations for 1633076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720