FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633077_at:

>probe:Drosophila_2:1633077_at:110:441; Interrogation_Position=1007; Antisense; GATGGCTGCGAGTCACACAGACCAA
>probe:Drosophila_2:1633077_at:193:283; Interrogation_Position=1045; Antisense; CTGCCCCAGGCCATAATTGTAGTTG
>probe:Drosophila_2:1633077_at:698:561; Interrogation_Position=1079; Antisense; GGAACGCGAGAGTTTTAGCCATTCT
>probe:Drosophila_2:1633077_at:617:477; Interrogation_Position=1090; Antisense; GTTTTAGCCATTCTTCAGCTCTAAC
>probe:Drosophila_2:1633077_at:174:153; Interrogation_Position=1116; Antisense; ACATCCCCACTTAGCCTGATTTTAC
>probe:Drosophila_2:1633077_at:593:459; Interrogation_Position=1133; Antisense; GATTTTACCATCTTCTTCATACCAT
>probe:Drosophila_2:1633077_at:687:645; Interrogation_Position=1149; Antisense; TCATACCATCTTCTTTCTCATTGAC
>probe:Drosophila_2:1633077_at:320:701; Interrogation_Position=1163; Antisense; TTCTCATTGACTCTTCGTCCTTTTG
>probe:Drosophila_2:1633077_at:651:701; Interrogation_Position=1183; Antisense; TTTTGCCTTCGTTTCTTTGTCACAA
>probe:Drosophila_2:1633077_at:100:99; Interrogation_Position=708; Antisense; AGATGAACATGGTGCCCATGCCCGC
>probe:Drosophila_2:1633077_at:141:57; Interrogation_Position=806; Antisense; ATGAGCGGAGGTCCCTATGCCCGTT
>probe:Drosophila_2:1633077_at:421:49; Interrogation_Position=822; Antisense; ATGCCCGTTGGGACTCGCAGAACCT
>probe:Drosophila_2:1633077_at:500:89; Interrogation_Position=955; Antisense; AGTCATTCGCCCAATTGTACATACC
>probe:Drosophila_2:1633077_at:365:71; Interrogation_Position=981; Antisense; AGGAATTTGCGATCCTTCCCAGGAA

Paste this into a BLAST search page for me
GATGGCTGCGAGTCACACAGACCAACTGCCCCAGGCCATAATTGTAGTTGGGAACGCGAGAGTTTTAGCCATTCTGTTTTAGCCATTCTTCAGCTCTAACACATCCCCACTTAGCCTGATTTTACGATTTTACCATCTTCTTCATACCATTCATACCATCTTCTTTCTCATTGACTTCTCATTGACTCTTCGTCCTTTTGTTTTGCCTTCGTTTCTTTGTCACAAAGATGAACATGGTGCCCATGCCCGCATGAGCGGAGGTCCCTATGCCCGTTATGCCCGTTGGGACTCGCAGAACCTAGTCATTCGCCCAATTGTACATACCAGGAATTTGCGATCCTTCCCAGGAA

Full Affymetrix probeset data:

Annotations for 1633077_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720