FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633078_at:

>probe:Drosophila_2:1633078_at:318:667; Interrogation_Position=1055; Antisense; TAGCCCGGTTTCCAAATGTTAGAAT
>probe:Drosophila_2:1633078_at:45:57; Interrogation_Position=1087; Antisense; ATGAGCAAACTGCATCCATCAATTT
>probe:Drosophila_2:1633078_at:187:147; Interrogation_Position=577; Antisense; ACTTACGGGCCGGAACGAGTCATCA
>probe:Drosophila_2:1633078_at:15:431; Interrogation_Position=593; Antisense; GAGTCATCACCTTGCGTCTAACATC
>probe:Drosophila_2:1633078_at:599:527; Interrogation_Position=642; Antisense; GGGATGGACCTTTACCGCAGGAATA
>probe:Drosophila_2:1633078_at:404:365; Interrogation_Position=662; Antisense; GAATAGACGATGTTCCCTCCGAGTG
>probe:Drosophila_2:1633078_at:493:639; Interrogation_Position=690; Antisense; TCTGGATGATCTGGCCGACGGCTTC
>probe:Drosophila_2:1633078_at:435:339; Interrogation_Position=710; Antisense; GCTTCGACGTGGTGTTGGCCAACGA
>probe:Drosophila_2:1633078_at:668:137; Interrogation_Position=734; Antisense; ACGAGGAACTCGACCAGGAGGCCAT
>probe:Drosophila_2:1633078_at:633:77; Interrogation_Position=749; Antisense; AGGAGGCCATCGACATTCTGCTGGA
>probe:Drosophila_2:1633078_at:245:43; Interrogation_Position=791; Antisense; ATCGATAGAGCTTGGACCTCTCGGC
>probe:Drosophila_2:1633078_at:607:639; Interrogation_Position=811; Antisense; TCGGCTCACCATGCTTTGAACAAAT
>probe:Drosophila_2:1633078_at:409:459; Interrogation_Position=844; Antisense; GATATATCACGTATTCCGGTCACAA
>probe:Drosophila_2:1633078_at:278:517; Interrogation_Position=951; Antisense; GTGTGGCGGTTTTACTAACTTGCAA

Paste this into a BLAST search page for me
TAGCCCGGTTTCCAAATGTTAGAATATGAGCAAACTGCATCCATCAATTTACTTACGGGCCGGAACGAGTCATCAGAGTCATCACCTTGCGTCTAACATCGGGATGGACCTTTACCGCAGGAATAGAATAGACGATGTTCCCTCCGAGTGTCTGGATGATCTGGCCGACGGCTTCGCTTCGACGTGGTGTTGGCCAACGAACGAGGAACTCGACCAGGAGGCCATAGGAGGCCATCGACATTCTGCTGGAATCGATAGAGCTTGGACCTCTCGGCTCGGCTCACCATGCTTTGAACAAATGATATATCACGTATTCCGGTCACAAGTGTGGCGGTTTTACTAACTTGCAA

Full Affymetrix probeset data:

Annotations for 1633078_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720