FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633079_at:

>probe:Drosophila_2:1633079_at:390:653; Interrogation_Position=135; Antisense; TATAAATACTTAGCCACCGGAAACG
>probe:Drosophila_2:1633079_at:390:391; Interrogation_Position=154; Antisense; GAAACGCGGAGTTCTCCCGGTGGAT
>probe:Drosophila_2:1633079_at:451:183; Interrogation_Position=182; Antisense; AAAAGTAAACAACGCTGCTGCCCGA
>probe:Drosophila_2:1633079_at:49:337; Interrogation_Position=195; Antisense; GCTGCTGCCCGAAGTAACCTTGAAG
>probe:Drosophila_2:1633079_at:8:445; Interrogation_Position=255; Antisense; GATGAACAACGCCAATTGCTTGAAG
>probe:Drosophila_2:1633079_at:609:661; Interrogation_Position=281; Antisense; TAACATTACTCAGCGCTTGAACACG
>probe:Drosophila_2:1633079_at:83:725; Interrogation_Position=297; Antisense; TTGAACACGCTCAGATCCCTAATAT
>probe:Drosophila_2:1633079_at:439:361; Interrogation_Position=337; Antisense; GCAAGAGATGTGTCCGATTCTACCA
>probe:Drosophila_2:1633079_at:561:303; Interrogation_Position=350; Antisense; CCGATTCTACCAGCATCAGGAAAAT
>probe:Drosophila_2:1633079_at:195:377; Interrogation_Position=437; Antisense; GAAGAAATGCTTTGCACCACCGGCG
>probe:Drosophila_2:1633079_at:241:129; Interrogation_Position=452; Antisense; ACCACCGGCGATACAAGAATATGAT
>probe:Drosophila_2:1633079_at:37:463; Interrogation_Position=480; Antisense; GATTACTATCTAGGCTATTGATCAT
>probe:Drosophila_2:1633079_at:275:365; Interrogation_Position=50; Antisense; GAATCTGGGCTTTGCCCTTAGTAGT
>probe:Drosophila_2:1633079_at:405:333; Interrogation_Position=98; Antisense; GCTGGTGACGTGGAGACTTCGAAAT

Paste this into a BLAST search page for me
TATAAATACTTAGCCACCGGAAACGGAAACGCGGAGTTCTCCCGGTGGATAAAAGTAAACAACGCTGCTGCCCGAGCTGCTGCCCGAAGTAACCTTGAAGGATGAACAACGCCAATTGCTTGAAGTAACATTACTCAGCGCTTGAACACGTTGAACACGCTCAGATCCCTAATATGCAAGAGATGTGTCCGATTCTACCACCGATTCTACCAGCATCAGGAAAATGAAGAAATGCTTTGCACCACCGGCGACCACCGGCGATACAAGAATATGATGATTACTATCTAGGCTATTGATCATGAATCTGGGCTTTGCCCTTAGTAGTGCTGGTGACGTGGAGACTTCGAAAT

Full Affymetrix probeset data:

Annotations for 1633079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720