Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633080_at:

>probe:Drosophila_2:1633080_at:215:507; Interrogation_Position=110; Antisense; GTGCCGCATAAAATTCGCCTCCATT
>probe:Drosophila_2:1633080_at:393:569; Interrogation_Position=138; Antisense; GGCATTCCGATGGACTACAGCTATA
>probe:Drosophila_2:1633080_at:236:87; Interrogation_Position=175; Antisense; AGTCGCCAGTGTTCATCAGCAAATG
>probe:Drosophila_2:1633080_at:686:167; Interrogation_Position=195; Antisense; AAATGTGCCCCGTACAACTTTCTGC
>probe:Drosophila_2:1633080_at:321:365; Interrogation_Position=222; Antisense; GAATACCGCCTAGGCTGCGATTGTA
>probe:Drosophila_2:1633080_at:438:491; Interrogation_Position=261; Antisense; GTCACACTGGTTAAGGAAGCCCGCA
>probe:Drosophila_2:1633080_at:345:509; Interrogation_Position=304; Antisense; GTGACCAGGAGCAGTCCTTGTTCGA
>probe:Drosophila_2:1633080_at:70:563; Interrogation_Position=329; Antisense; GGAAGTCCCCTATTTGATGGCCCAA
>probe:Drosophila_2:1633080_at:416:555; Interrogation_Position=357; Antisense; GGACCATCCATCGAGTCGGCAATGA
>probe:Drosophila_2:1633080_at:290:79; Interrogation_Position=381; Antisense; AGGTTAACCGTCAATGTCCTGTCGC
>probe:Drosophila_2:1633080_at:279:257; Interrogation_Position=423; Antisense; CAAAGGACGCGCTCTGATGTTCAGT
>probe:Drosophila_2:1633080_at:295:31; Interrogation_Position=46; Antisense; ATAAAACACATTTCCCAGTGCCACG
>probe:Drosophila_2:1633080_at:235:129; Interrogation_Position=561; Antisense; ACCAGGTATACATCCCAATTTCACT
>probe:Drosophila_2:1633080_at:699:307; Interrogation_Position=60; Antisense; CCAGTGCCACGACTTTACCAAAATT

Paste this into a BLAST search page for me
GTGCCGCATAAAATTCGCCTCCATTGGCATTCCGATGGACTACAGCTATAAGTCGCCAGTGTTCATCAGCAAATGAAATGTGCCCCGTACAACTTTCTGCGAATACCGCCTAGGCTGCGATTGTAGTCACACTGGTTAAGGAAGCCCGCAGTGACCAGGAGCAGTCCTTGTTCGAGGAAGTCCCCTATTTGATGGCCCAAGGACCATCCATCGAGTCGGCAATGAAGGTTAACCGTCAATGTCCTGTCGCCAAAGGACGCGCTCTGATGTTCAGTATAAAACACATTTCCCAGTGCCACGACCAGGTATACATCCCAATTTCACTCCAGTGCCACGACTTTACCAAAATT

Full Affymetrix probeset data:

Annotations for 1633080_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime