FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633081_at:

>probe:Drosophila_2:1633081_at:247:553; Interrogation_Position=4534; Antisense; GGAGCAATATCCAACAGAGCCCAGC
>probe:Drosophila_2:1633081_at:480:111; Interrogation_Position=4536; Antisense; AGCAATATCCAACAGAGCCCAGCAT
>probe:Drosophila_2:1633081_at:45:243; Interrogation_Position=4539; Antisense; AATATCCAACAGAGCCCAGCATTTA
>probe:Drosophila_2:1633081_at:155:153; Interrogation_Position=4547; Antisense; ACAGAGCCCAGCATTTAAAACAAAT
>probe:Drosophila_2:1633081_at:309:159; Interrogation_Position=4566; Antisense; ACAAATGCAGCAATCACTTTCTTTT
>probe:Drosophila_2:1633081_at:622:53; Interrogation_Position=4570; Antisense; ATGCAGCAATCACTTTCTTTTACCA
>probe:Drosophila_2:1633081_at:98:351; Interrogation_Position=4572; Antisense; GCAGCAATCACTTTCTTTTACCAGT
>probe:Drosophila_2:1633081_at:511:237; Interrogation_Position=4577; Antisense; AATCACTTTCTTTTACCAGTTTCTG
>probe:Drosophila_2:1633081_at:3:259; Interrogation_Position=4580; Antisense; CACTTTCTTTTACCAGTTTCTGTAT
>probe:Drosophila_2:1633081_at:211:669; Interrogation_Position=4590; Antisense; TACCAGTTTCTGTATAAATATAACC
>probe:Drosophila_2:1633081_at:239:595; Interrogation_Position=4672; Antisense; TGTGTATTAAATTCCTCTAGTTTTT
>probe:Drosophila_2:1633081_at:183:701; Interrogation_Position=4693; Antisense; TTTTAAGCCTTTCGTTCAGAATTGG
>probe:Drosophila_2:1633081_at:472:657; Interrogation_Position=4696; Antisense; TAAGCCTTTCGTTCAGAATTGGAAT
>probe:Drosophila_2:1633081_at:648:313; Interrogation_Position=4699; Antisense; GCCTTTCGTTCAGAATTGGAATAAA

Paste this into a BLAST search page for me
GGAGCAATATCCAACAGAGCCCAGCAGCAATATCCAACAGAGCCCAGCATAATATCCAACAGAGCCCAGCATTTAACAGAGCCCAGCATTTAAAACAAATACAAATGCAGCAATCACTTTCTTTTATGCAGCAATCACTTTCTTTTACCAGCAGCAATCACTTTCTTTTACCAGTAATCACTTTCTTTTACCAGTTTCTGCACTTTCTTTTACCAGTTTCTGTATTACCAGTTTCTGTATAAATATAACCTGTGTATTAAATTCCTCTAGTTTTTTTTTAAGCCTTTCGTTCAGAATTGGTAAGCCTTTCGTTCAGAATTGGAATGCCTTTCGTTCAGAATTGGAATAAA

Full Affymetrix probeset data:

Annotations for 1633081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720