Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633082_at:

>probe:Drosophila_2:1633082_at:523:139; Interrogation_Position=1781; Antisense; ACTCGGTCGGACACTGGACGGGATT
>probe:Drosophila_2:1633082_at:678:417; Interrogation_Position=1809; Antisense; GAGCTATGCAGCTTTCTGGACGTTA
>probe:Drosophila_2:1633082_at:356:409; Interrogation_Position=1827; Antisense; GACGTTAAATTCATGTTCCCGCTGC
>probe:Drosophila_2:1633082_at:48:181; Interrogation_Position=1907; Antisense; AAACACTGTCAGCAAACCGCCAAAG
>probe:Drosophila_2:1633082_at:525:643; Interrogation_Position=1972; Antisense; TCTCTGCGACTGGTGGCTATCAGAT
>probe:Drosophila_2:1633082_at:205:35; Interrogation_Position=1990; Antisense; ATCAGATGCCTGAGAACGCCTTTAT
>probe:Drosophila_2:1633082_at:344:699; Interrogation_Position=2010; Antisense; TTTATGCACAGCTCGATGCGACGGC
>probe:Drosophila_2:1633082_at:269:295; Interrogation_Position=2057; Antisense; CGAGCTGTCCACGATAACGAGCGAT
>probe:Drosophila_2:1633082_at:508:387; Interrogation_Position=2092; Antisense; GAAACGCGGTGGTGCAAAACGGATT
>probe:Drosophila_2:1633082_at:724:181; Interrogation_Position=2107; Antisense; AAAACGGATTGCCAGCTGCGGAGCC
>probe:Drosophila_2:1633082_at:144:555; Interrogation_Position=2126; Antisense; GGAGCCTCAGCAACGGCATCGAAAC
>probe:Drosophila_2:1633082_at:495:235; Interrogation_Position=2152; Antisense; AATCGAGTTGATCGTAAGGTCCACT
>probe:Drosophila_2:1633082_at:389:657; Interrogation_Position=2166; Antisense; TAAGGTCCACTCCTAACGACTGAAA
>probe:Drosophila_2:1633082_at:139:503; Interrogation_Position=2294; Antisense; GTCCATAGTTTGTAATTTTCTCCAT

Paste this into a BLAST search page for me
ACTCGGTCGGACACTGGACGGGATTGAGCTATGCAGCTTTCTGGACGTTAGACGTTAAATTCATGTTCCCGCTGCAAACACTGTCAGCAAACCGCCAAAGTCTCTGCGACTGGTGGCTATCAGATATCAGATGCCTGAGAACGCCTTTATTTTATGCACAGCTCGATGCGACGGCCGAGCTGTCCACGATAACGAGCGATGAAACGCGGTGGTGCAAAACGGATTAAAACGGATTGCCAGCTGCGGAGCCGGAGCCTCAGCAACGGCATCGAAACAATCGAGTTGATCGTAAGGTCCACTTAAGGTCCACTCCTAACGACTGAAAGTCCATAGTTTGTAATTTTCTCCAT

Full Affymetrix probeset data:

Annotations for 1633082_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime