FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633083_at:

>probe:Drosophila_2:1633083_at:125:503; Interrogation_Position=128; Antisense; GTCCCACAAGTACACGGAGCTGATT
>probe:Drosophila_2:1633083_at:511:149; Interrogation_Position=13; Antisense; ACTTGGAAATCAGCTGTCGCTTGTT
>probe:Drosophila_2:1633083_at:670:289; Interrogation_Position=142; Antisense; CGGAGCTGATTAAGGTCGGCACGCA
>probe:Drosophila_2:1633083_at:445:355; Interrogation_Position=160; Antisense; GCACGCAGTATGCTCGCCGGATGAA
>probe:Drosophila_2:1633083_at:86:547; Interrogation_Position=178; Antisense; GGATGAACTACCTCTCAAATCGCAT
>probe:Drosophila_2:1633083_at:282:373; Interrogation_Position=210; Antisense; GAAGTGGCTCGCACCACAAACGAGA
>probe:Drosophila_2:1633083_at:503:519; Interrogation_Position=246; Antisense; GTGGTTCGCATGTTCTCGGAGGAAC
>probe:Drosophila_2:1633083_at:12:379; Interrogation_Position=267; Antisense; GAACCAATTCACAAACGGGACTACG
>probe:Drosophila_2:1633083_at:333:499; Interrogation_Position=28; Antisense; GTCGCTTGTTTTTGTTTCGTGACAT
>probe:Drosophila_2:1633083_at:198:669; Interrogation_Position=288; Antisense; TACGTGATCAACTGGTATCCGCGGC
>probe:Drosophila_2:1633083_at:107:141; Interrogation_Position=313; Antisense; ACGTGGAGACGCACTTGCTGATGAA
>probe:Drosophila_2:1633083_at:121:55; Interrogation_Position=333; Antisense; ATGAAGAACCTTCGCGACTACGGAC
>probe:Drosophila_2:1633083_at:701:403; Interrogation_Position=355; Antisense; GACTGTTCCGCGATGAGCACCAGGA
>probe:Drosophila_2:1633083_at:363:357; Interrogation_Position=445; Antisense; GCAAGCGGGCCTCAAAGAAGTAGTA

Paste this into a BLAST search page for me
GTCCCACAAGTACACGGAGCTGATTACTTGGAAATCAGCTGTCGCTTGTTCGGAGCTGATTAAGGTCGGCACGCAGCACGCAGTATGCTCGCCGGATGAAGGATGAACTACCTCTCAAATCGCATGAAGTGGCTCGCACCACAAACGAGAGTGGTTCGCATGTTCTCGGAGGAACGAACCAATTCACAAACGGGACTACGGTCGCTTGTTTTTGTTTCGTGACATTACGTGATCAACTGGTATCCGCGGCACGTGGAGACGCACTTGCTGATGAAATGAAGAACCTTCGCGACTACGGACGACTGTTCCGCGATGAGCACCAGGAGCAAGCGGGCCTCAAAGAAGTAGTA

Full Affymetrix probeset data:

Annotations for 1633083_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720