FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633087_at:

>probe:Drosophila_2:1633087_at:61:527; Interrogation_Position=1098; Antisense; GGGCAAGGGCAAATCCAATGTCGAT
>probe:Drosophila_2:1633087_at:291:303; Interrogation_Position=1112; Antisense; CCAATGTCGATTGCTTGGCGGGCGA
>probe:Drosophila_2:1633087_at:361:551; Interrogation_Position=1146; Antisense; GGAGATCCAGATTGAAATACCCATG
>probe:Drosophila_2:1633087_at:88:281; Interrogation_Position=1212; Antisense; CTCGACGGCCTCGAGTCATGTGTAA
>probe:Drosophila_2:1633087_at:120:627; Interrogation_Position=668; Antisense; TGCCTTTCTTCCTGTGGTACACACT
>probe:Drosophila_2:1633087_at:724:627; Interrogation_Position=694; Antisense; TCCATGACCTGCGAGGAGTGCCAAG
>probe:Drosophila_2:1633087_at:248:219; Interrogation_Position=716; Antisense; AAGTGCCGGACATAGTCGTCTCAAT
>probe:Drosophila_2:1633087_at:528:677; Interrogation_Position=728; Antisense; TAGTCGTCTCAATCCTCTTCTGGAT
>probe:Drosophila_2:1633087_at:72:277; Interrogation_Position=744; Antisense; CTTCTGGATCGGGTACTTCAACTCA
>probe:Drosophila_2:1633087_at:278:605; Interrogation_Position=782; Antisense; TGATCTACGCGTACTTCAACCGCGA
>probe:Drosophila_2:1633087_at:291:283; Interrogation_Position=837; Antisense; CTGCCTGTTCTGCAATTGGTGGAAG
>probe:Drosophila_2:1633087_at:308:213; Interrogation_Position=925; Antisense; AAGAGCGTCTACTCGGAGAGCTACC
>probe:Drosophila_2:1633087_at:284:425; Interrogation_Position=940; Antisense; GAGAGCTACCTTAACTCGACAACGC
>probe:Drosophila_2:1633087_at:596:319; Interrogation_Position=974; Antisense; GCCGCCAGTCTCAGATGCAGCAGCA

Paste this into a BLAST search page for me
GGGCAAGGGCAAATCCAATGTCGATCCAATGTCGATTGCTTGGCGGGCGAGGAGATCCAGATTGAAATACCCATGCTCGACGGCCTCGAGTCATGTGTAATGCCTTTCTTCCTGTGGTACACACTTCCATGACCTGCGAGGAGTGCCAAGAAGTGCCGGACATAGTCGTCTCAATTAGTCGTCTCAATCCTCTTCTGGATCTTCTGGATCGGGTACTTCAACTCATGATCTACGCGTACTTCAACCGCGACTGCCTGTTCTGCAATTGGTGGAAGAAGAGCGTCTACTCGGAGAGCTACCGAGAGCTACCTTAACTCGACAACGCGCCGCCAGTCTCAGATGCAGCAGCA

Full Affymetrix probeset data:

Annotations for 1633087_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720