Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633088_at:

>probe:Drosophila_2:1633088_at:495:599; Interrogation_Position=2441; Antisense; TGTCATCGCGCATCGTGGAGCGAAT
>probe:Drosophila_2:1633088_at:539:237; Interrogation_Position=2463; Antisense; AATCTTCTCGGGATGTGTAACGCGC
>probe:Drosophila_2:1633088_at:173:55; Interrogation_Position=2513; Antisense; ATGAAGCCAAGATGTCCTACACGGA
>probe:Drosophila_2:1633088_at:362:147; Interrogation_Position=2537; Antisense; ACTTTGTGTGGTTCATCCTCTCGGA
>probe:Drosophila_2:1633088_at:158:407; Interrogation_Position=2580; Antisense; GACGGCCATCGAGTACTGGTTTAGA
>probe:Drosophila_2:1633088_at:668:549; Interrogation_Position=2626; Antisense; GGAGTGCTGTCCATGTACGAACTGG
>probe:Drosophila_2:1633088_at:559:725; Interrogation_Position=2696; Antisense; TTGAGTGCCTGCCTTTCGAGGACTG
>probe:Drosophila_2:1633088_at:478:405; Interrogation_Position=2716; Antisense; GACTGCCTGTGCCAGATGCTAGATA
>probe:Drosophila_2:1633088_at:34:165; Interrogation_Position=2754; Antisense; AAATCGGGACTGTATCACGCTGGGC
>probe:Drosophila_2:1633088_at:571:167; Interrogation_Position=2795; Antisense; AAATGACGCACGTCTTCTTCGATAC
>probe:Drosophila_2:1633088_at:596:275; Interrogation_Position=2811; Antisense; CTTCGATACCTTCTTCAATCTGGAG
>probe:Drosophila_2:1633088_at:258:387; Interrogation_Position=2851; Antisense; GAACAACGAGATCCGTTTGCCTCAC
>probe:Drosophila_2:1633088_at:385:327; Interrogation_Position=2877; Antisense; GCGTGACGAATATACCTCCGATTGG
>probe:Drosophila_2:1633088_at:320:29; Interrogation_Position=2922; Antisense; ATACGAACTGCTCATATCCGAGGAA

Paste this into a BLAST search page for me
TGTCATCGCGCATCGTGGAGCGAATAATCTTCTCGGGATGTGTAACGCGCATGAAGCCAAGATGTCCTACACGGAACTTTGTGTGGTTCATCCTCTCGGAGACGGCCATCGAGTACTGGTTTAGAGGAGTGCTGTCCATGTACGAACTGGTTGAGTGCCTGCCTTTCGAGGACTGGACTGCCTGTGCCAGATGCTAGATAAAATCGGGACTGTATCACGCTGGGCAAATGACGCACGTCTTCTTCGATACCTTCGATACCTTCTTCAATCTGGAGGAACAACGAGATCCGTTTGCCTCACGCGTGACGAATATACCTCCGATTGGATACGAACTGCTCATATCCGAGGAA

Full Affymetrix probeset data:

Annotations for 1633088_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime