FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633090_at:

>probe:Drosophila_2:1633090_at:627:333; Interrogation_Position=4263; Antisense; GCTGTTGTATTTGTAAGCCCGAAAT
>probe:Drosophila_2:1633090_at:462:207; Interrogation_Position=4371; Antisense; AAGCTTGGCTCGAAATCGATTTCAT
>probe:Drosophila_2:1633090_at:584:475; Interrogation_Position=4435; Antisense; GTTTGTTTTTTCAGAAGACCTGCCA
>probe:Drosophila_2:1633090_at:413:375; Interrogation_Position=4448; Antisense; GAAGACCTGCCAACAAACTTGTCAA
>probe:Drosophila_2:1633090_at:549:371; Interrogation_Position=4506; Antisense; GAAGGCATTCTTTGGCACAGCATGA
>probe:Drosophila_2:1633090_at:135:569; Interrogation_Position=4542; Antisense; GGCAGGACATACAATTCCGAGCAGA
>probe:Drosophila_2:1633090_at:253:173; Interrogation_Position=4602; Antisense; AAAGCAGCTTCGAGTCAAACACAAA
>probe:Drosophila_2:1633090_at:377:709; Interrogation_Position=4680; Antisense; TTAAAACAGCTCATTCTGTCCCTGG
>probe:Drosophila_2:1633090_at:726:631; Interrogation_Position=4698; Antisense; TCCCTGGCCGTGTGTGGGTGTATAT
>probe:Drosophila_2:1633090_at:276:517; Interrogation_Position=4709; Antisense; GTGTGGGTGTATATTTGTCTGCTCG
>probe:Drosophila_2:1633090_at:618:19; Interrogation_Position=4721; Antisense; ATTTGTCTGCTCGTAGAGGTTTCCA
>probe:Drosophila_2:1633090_at:26:485; Interrogation_Position=4733; Antisense; GTAGAGGTTTCCATGACCACTCACC
>probe:Drosophila_2:1633090_at:712:131; Interrogation_Position=4755; Antisense; ACCCAACCAAAGAGCCATCCAGAAG
>probe:Drosophila_2:1633090_at:45:49; Interrogation_Position=4771; Antisense; ATCCAGAAGTGCAGGGCGGACCACC

Paste this into a BLAST search page for me
GCTGTTGTATTTGTAAGCCCGAAATAAGCTTGGCTCGAAATCGATTTCATGTTTGTTTTTTCAGAAGACCTGCCAGAAGACCTGCCAACAAACTTGTCAAGAAGGCATTCTTTGGCACAGCATGAGGCAGGACATACAATTCCGAGCAGAAAAGCAGCTTCGAGTCAAACACAAATTAAAACAGCTCATTCTGTCCCTGGTCCCTGGCCGTGTGTGGGTGTATATGTGTGGGTGTATATTTGTCTGCTCGATTTGTCTGCTCGTAGAGGTTTCCAGTAGAGGTTTCCATGACCACTCACCACCCAACCAAAGAGCCATCCAGAAGATCCAGAAGTGCAGGGCGGACCACC

Full Affymetrix probeset data:

Annotations for 1633090_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720