FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633091_at:

>probe:Drosophila_2:1633091_at:564:441; Interrogation_Position=248; Antisense; GATGAGTTCTACCACCATATGATCA
>probe:Drosophila_2:1633091_at:56:33; Interrogation_Position=269; Antisense; ATCAACTCCAAGCTGTCCAACGATG
>probe:Drosophila_2:1633091_at:621:597; Interrogation_Position=282; Antisense; TGTCCAACGATGAGCACCACGAGAA
>probe:Drosophila_2:1633091_at:290:371; Interrogation_Position=313; Antisense; GAAGGACGAGCACACGCCCGAGCAA
>probe:Drosophila_2:1633091_at:22:249; Interrogation_Position=336; Antisense; AATTGGCCCTCATGCAGACGCAGGA
>probe:Drosophila_2:1633091_at:13:619; Interrogation_Position=348; Antisense; TGCAGACGCAGGACCTCAAGTACGT
>probe:Drosophila_2:1633091_at:492:97; Interrogation_Position=402; Antisense; AGATCGAACGCTTGAAGGCCTCGCT
>probe:Drosophila_2:1633091_at:601:635; Interrogation_Position=422; Antisense; TCGCTGGTGGACGTGGATGCCATTA
>probe:Drosophila_2:1633091_at:278:529; Interrogation_Position=448; Antisense; GGGAGCAGCCAACAAACGTATCAAA
>probe:Drosophila_2:1633091_at:523:113; Interrogation_Position=624; Antisense; AGCAGCGTGAAAGGGAACTCGGCAT
>probe:Drosophila_2:1633091_at:552:193; Interrogation_Position=639; Antisense; AACTCGGCATCGTCCAGCAGAAGAT
>probe:Drosophila_2:1633091_at:485:127; Interrogation_Position=687; Antisense; AGCCACGCCTACTGAAGCCGAGGAA
>probe:Drosophila_2:1633091_at:320:559; Interrogation_Position=722; Antisense; GGAACCAAGGACAGTGCGCCCGTCT
>probe:Drosophila_2:1633091_at:78:665; Interrogation_Position=746; Antisense; TACAAATTCCGCTACGAACGCAAGA

Paste this into a BLAST search page for me
GATGAGTTCTACCACCATATGATCAATCAACTCCAAGCTGTCCAACGATGTGTCCAACGATGAGCACCACGAGAAGAAGGACGAGCACACGCCCGAGCAAAATTGGCCCTCATGCAGACGCAGGATGCAGACGCAGGACCTCAAGTACGTAGATCGAACGCTTGAAGGCCTCGCTTCGCTGGTGGACGTGGATGCCATTAGGGAGCAGCCAACAAACGTATCAAAAGCAGCGTGAAAGGGAACTCGGCATAACTCGGCATCGTCCAGCAGAAGATAGCCACGCCTACTGAAGCCGAGGAAGGAACCAAGGACAGTGCGCCCGTCTTACAAATTCCGCTACGAACGCAAGA

Full Affymetrix probeset data:

Annotations for 1633091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720