Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633092_at:

>probe:Drosophila_2:1633092_at:464:363; Interrogation_Position=3440; Antisense; GAATTCGCTTCATCAGAACAACGCT
>probe:Drosophila_2:1633092_at:601:133; Interrogation_Position=3460; Antisense; ACGCTGGAGCTGTCAATAGCTTCAA
>probe:Drosophila_2:1633092_at:316:239; Interrogation_Position=3505; Antisense; AATCAGCTATTTCCATGCTGCCCAA
>probe:Drosophila_2:1633092_at:168:547; Interrogation_Position=3536; Antisense; GGATGAGTTTCATTAACGGCTTCAA
>probe:Drosophila_2:1633092_at:181:183; Interrogation_Position=3559; Antisense; AAAAGATTCGCCACAACGACGGTTG
>probe:Drosophila_2:1633092_at:395:199; Interrogation_Position=3573; Antisense; AACGACGGTTGGTCTGATGGCCATC
>probe:Drosophila_2:1633092_at:101:441; Interrogation_Position=3588; Antisense; GATGGCCATCGGTATTGGATCGACT
>probe:Drosophila_2:1633092_at:396:405; Interrogation_Position=3609; Antisense; GACTGTTATATTCTACACCACCCAT
>probe:Drosophila_2:1633092_at:477:29; Interrogation_Position=3643; Antisense; ATCAAACCCTATCTTCTCGAGAAAC
>probe:Drosophila_2:1633092_at:398:203; Interrogation_Position=3677; Antisense; AAGCCGAGGCCAGTGCGGAGTACCT
>probe:Drosophila_2:1633092_at:660:435; Interrogation_Position=3712; Antisense; GAGGTTCACTCCCAGATTGGCGAGT
>probe:Drosophila_2:1633092_at:695:313; Interrogation_Position=3772; Antisense; GCCAGTGCCGTCATAGACATCTTTA
>probe:Drosophila_2:1633092_at:243:653; Interrogation_Position=3866; Antisense; TACTTTCTTACCTTCACTTTGGGTG
>probe:Drosophila_2:1633092_at:148:577; Interrogation_Position=3895; Antisense; GGCCCATCTTCTTGTGTTCATTTTA

Paste this into a BLAST search page for me
GAATTCGCTTCATCAGAACAACGCTACGCTGGAGCTGTCAATAGCTTCAAAATCAGCTATTTCCATGCTGCCCAAGGATGAGTTTCATTAACGGCTTCAAAAAAGATTCGCCACAACGACGGTTGAACGACGGTTGGTCTGATGGCCATCGATGGCCATCGGTATTGGATCGACTGACTGTTATATTCTACACCACCCATATCAAACCCTATCTTCTCGAGAAACAAGCCGAGGCCAGTGCGGAGTACCTGAGGTTCACTCCCAGATTGGCGAGTGCCAGTGCCGTCATAGACATCTTTATACTTTCTTACCTTCACTTTGGGTGGGCCCATCTTCTTGTGTTCATTTTA

Full Affymetrix probeset data:

Annotations for 1633092_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime