FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633093_at:

>probe:Drosophila_2:1633093_at:233:419; Interrogation_Position=1804; Antisense; GAGCTCGACGCATGTTTCTACATCG
>probe:Drosophila_2:1633093_at:510:43; Interrogation_Position=1825; Antisense; ATCGATCAGGGCTATTTCTCGCAGA
>probe:Drosophila_2:1633093_at:715:563; Interrogation_Position=1857; Antisense; GGCAGCTGAGTTGCACATCTACGAT
>probe:Drosophila_2:1633093_at:140:373; Interrogation_Position=1908; Antisense; GAAGTTTAGCCGCAGCCAGTGGAAT
>probe:Drosophila_2:1633093_at:297:513; Interrogation_Position=1949; Antisense; GTGATCTCGTGCTTTGTCTACAAAA
>probe:Drosophila_2:1633093_at:696:127; Interrogation_Position=2032; Antisense; ACCTTTGTGGATGTTTCGGAGCTCT
>probe:Drosophila_2:1633093_at:671:289; Interrogation_Position=2048; Antisense; CGGAGCTCTGTTCGGACGATACCAA
>probe:Drosophila_2:1633093_at:91:453; Interrogation_Position=2083; Antisense; GATCTGCATCAGCTTATCAACTCTA
>probe:Drosophila_2:1633093_at:521:51; Interrogation_Position=2128; Antisense; ATGCGTAATCGCGATGCCAACCAGA
>probe:Drosophila_2:1633093_at:608:687; Interrogation_Position=2158; Antisense; TATATTCGCCAGCTCCTTCAGGAGA
>probe:Drosophila_2:1633093_at:486:609; Interrogation_Position=2192; Antisense; TGAGCTTCTCCTAGAACTCCATGTA
>probe:Drosophila_2:1633093_at:563:383; Interrogation_Position=2205; Antisense; GAACTCCATGTATTCACAAGCCACG
>probe:Drosophila_2:1633093_at:1:291; Interrogation_Position=2228; Antisense; CGGATATCCGTAATCGCGATGCCAA
>probe:Drosophila_2:1633093_at:560:103; Interrogation_Position=2352; Antisense; AGACCACAGCGTACACTTTCCAATT

Paste this into a BLAST search page for me
GAGCTCGACGCATGTTTCTACATCGATCGATCAGGGCTATTTCTCGCAGAGGCAGCTGAGTTGCACATCTACGATGAAGTTTAGCCGCAGCCAGTGGAATGTGATCTCGTGCTTTGTCTACAAAAACCTTTGTGGATGTTTCGGAGCTCTCGGAGCTCTGTTCGGACGATACCAAGATCTGCATCAGCTTATCAACTCTAATGCGTAATCGCGATGCCAACCAGATATATTCGCCAGCTCCTTCAGGAGATGAGCTTCTCCTAGAACTCCATGTAGAACTCCATGTATTCACAAGCCACGCGGATATCCGTAATCGCGATGCCAAAGACCACAGCGTACACTTTCCAATT

Full Affymetrix probeset data:

Annotations for 1633093_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720