FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633097_at:

>probe:Drosophila_2:1633097_at:9:37; Interrogation_Position=116; Antisense; ATCATGAGCACCACGAGCCGGAGCA
>probe:Drosophila_2:1633097_at:238:113; Interrogation_Position=137; Antisense; AGCACCATGTGAAGTACGAGCCGGA
>probe:Drosophila_2:1633097_at:118:253; Interrogation_Position=18; Antisense; CAAGTTGGCTATTACCTGCCTGGCC
>probe:Drosophila_2:1633097_at:6:129; Interrogation_Position=215; Antisense; ACCAGAGCGTCAAGTTCCACCACTA
>probe:Drosophila_2:1633097_at:309:305; Interrogation_Position=245; Antisense; CCGTGCCCGTCTACATCAAGAAGGA
>probe:Drosophila_2:1633097_at:156:653; Interrogation_Position=260; Antisense; TCAAGAAGGAGGACCAGCACCTGGT
>probe:Drosophila_2:1633097_at:255:113; Interrogation_Position=275; Antisense; AGCACCTGGTGAAAAAGCCTATCGA
>probe:Drosophila_2:1633097_at:277:427; Interrogation_Position=298; Antisense; GAGATCGGCGGCACCAAGCAGAAGC
>probe:Drosophila_2:1633097_at:212:109; Interrogation_Position=317; Antisense; AGAAGCTGAAGATCCTGCACCCGAA
>probe:Drosophila_2:1633097_at:341:449; Interrogation_Position=327; Antisense; GATCCTGCACCCGAAGAGTGAGCAC
>probe:Drosophila_2:1633097_at:41:161; Interrogation_Position=356; Antisense; ACAACCACGGACTGGTGCTCGAAAA
>probe:Drosophila_2:1633097_at:391:75; Interrogation_Position=416; Antisense; AGGAGCCGGTGCACCACTCGGAGCA
>probe:Drosophila_2:1633097_at:603:715; Interrogation_Position=44; Antisense; TTCTGGCCGTTAGTGGAGCTCTGAA
>probe:Drosophila_2:1633097_at:401:419; Interrogation_Position=59; Antisense; GAGCTCTGAAGATCCACGACTACCA

Paste this into a BLAST search page for me
ATCATGAGCACCACGAGCCGGAGCAAGCACCATGTGAAGTACGAGCCGGACAAGTTGGCTATTACCTGCCTGGCCACCAGAGCGTCAAGTTCCACCACTACCGTGCCCGTCTACATCAAGAAGGATCAAGAAGGAGGACCAGCACCTGGTAGCACCTGGTGAAAAAGCCTATCGAGAGATCGGCGGCACCAAGCAGAAGCAGAAGCTGAAGATCCTGCACCCGAAGATCCTGCACCCGAAGAGTGAGCACACAACCACGGACTGGTGCTCGAAAAAGGAGCCGGTGCACCACTCGGAGCATTCTGGCCGTTAGTGGAGCTCTGAAGAGCTCTGAAGATCCACGACTACCA

Full Affymetrix probeset data:

Annotations for 1633097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720