Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633099_at:

>probe:Drosophila_2:1633099_at:225:513; Interrogation_Position=771; Antisense; GTGAGGCACAACTCGCATTGCGAGG
>probe:Drosophila_2:1633099_at:468:7; Interrogation_Position=787; Antisense; ATTGCGAGGCGGGAGTCTATACTTT
>probe:Drosophila_2:1633099_at:395:87; Interrogation_Position=800; Antisense; AGTCTATACTTTCTTCGCGTTGTTC
>probe:Drosophila_2:1633099_at:37:647; Interrogation_Position=811; Antisense; TCTTCGCGTTGTTCGAGTACATCGT
>probe:Drosophila_2:1633099_at:455:637; Interrogation_Position=823; Antisense; TCGAGTACATCGTGGTGCTGACCAA
>probe:Drosophila_2:1633099_at:371:541; Interrogation_Position=853; Antisense; GGTTCCACATGACCTCCTACTGGGA
>probe:Drosophila_2:1633099_at:447:669; Interrogation_Position=870; Antisense; TACTGGGACTTCTACGCCCTGAATG
>probe:Drosophila_2:1633099_at:465:279; Interrogation_Position=881; Antisense; CTACGCCCTGAATGTGGTGTGTGAT
>probe:Drosophila_2:1633099_at:43:595; Interrogation_Position=898; Antisense; TGTGTGATGCCAAGCACGGTCTCTA
>probe:Drosophila_2:1633099_at:604:139; Interrogation_Position=913; Antisense; ACGGTCTCTACCTATCACAATCGTA
>probe:Drosophila_2:1633099_at:496:649; Interrogation_Position=927; Antisense; TCACAATCGTAGACCAATGAACTAG
>probe:Drosophila_2:1633099_at:394:613; Interrogation_Position=944; Antisense; TGAACTAGATCAAACCCAGCCTGCG
>probe:Drosophila_2:1633099_at:68:19; Interrogation_Position=974; Antisense; ATTTCAGCCAGCCAGTCGTCCTCGA
>probe:Drosophila_2:1633099_at:637:499; Interrogation_Position=988; Antisense; GTCGTCCTCGAGTATTGTGTACATA

Paste this into a BLAST search page for me
GTGAGGCACAACTCGCATTGCGAGGATTGCGAGGCGGGAGTCTATACTTTAGTCTATACTTTCTTCGCGTTGTTCTCTTCGCGTTGTTCGAGTACATCGTTCGAGTACATCGTGGTGCTGACCAAGGTTCCACATGACCTCCTACTGGGATACTGGGACTTCTACGCCCTGAATGCTACGCCCTGAATGTGGTGTGTGATTGTGTGATGCCAAGCACGGTCTCTAACGGTCTCTACCTATCACAATCGTATCACAATCGTAGACCAATGAACTAGTGAACTAGATCAAACCCAGCCTGCGATTTCAGCCAGCCAGTCGTCCTCGAGTCGTCCTCGAGTATTGTGTACATA

Full Affymetrix probeset data:

Annotations for 1633099_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime