FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633102_at:

>probe:Drosophila_2:1633102_at:464:605; Interrogation_Position=110; Antisense; TGATGTGGACGGGTCTTTTGGTTCC
>probe:Drosophila_2:1633102_at:573:481; Interrogation_Position=192; Antisense; GTATCCCTTTATGCCACCAAAGATC
>probe:Drosophila_2:1633102_at:640:143; Interrogation_Position=22; Antisense; ACTCGTCGTCTGACACGGGAACTCT
>probe:Drosophila_2:1633102_at:607:387; Interrogation_Position=228; Antisense; GAAAATCTATCACCCCAACGTGGAT
>probe:Drosophila_2:1633102_at:653:111; Interrogation_Position=283; Antisense; AGCACAGACAACTGGAAGCCCACAA
>probe:Drosophila_2:1633102_at:124:201; Interrogation_Position=306; Antisense; AACGCGCACAGAGCAGGTGCTCCAG
>probe:Drosophila_2:1633102_at:307:591; Interrogation_Position=335; Antisense; TGGTAGCCATCGTCCACAACCCGGA
>probe:Drosophila_2:1633102_at:507:107; Interrogation_Position=363; Antisense; AGAACATCCGCTTCGTTCTGACCTG
>probe:Drosophila_2:1633102_at:726:635; Interrogation_Position=379; Antisense; TCTGACCTGGCCGAGGAGTTCGTAA
>probe:Drosophila_2:1633102_at:223:383; Interrogation_Position=40; Antisense; GAACTCTCCGATCTGGTTGAGGCCA
>probe:Drosophila_2:1633102_at:606:175; Interrogation_Position=424; Antisense; AAGACGGCCGAAGAGTTCACCAAGA
>probe:Drosophila_2:1633102_at:68:441; Interrogation_Position=58; Antisense; GAGGCCAAGATGAGCACTCTGCGCA
>probe:Drosophila_2:1633102_at:436:421; Interrogation_Position=69; Antisense; GAGCACTCTGCGCAACATCGAGAGT
>probe:Drosophila_2:1633102_at:101:101; Interrogation_Position=89; Antisense; AGAGTAGCGATGAGTCCCTGCTGAT

Paste this into a BLAST search page for me
TGATGTGGACGGGTCTTTTGGTTCCGTATCCCTTTATGCCACCAAAGATCACTCGTCGTCTGACACGGGAACTCTGAAAATCTATCACCCCAACGTGGATAGCACAGACAACTGGAAGCCCACAAAACGCGCACAGAGCAGGTGCTCCAGTGGTAGCCATCGTCCACAACCCGGAAGAACATCCGCTTCGTTCTGACCTGTCTGACCTGGCCGAGGAGTTCGTAAGAACTCTCCGATCTGGTTGAGGCCAAAGACGGCCGAAGAGTTCACCAAGAGAGGCCAAGATGAGCACTCTGCGCAGAGCACTCTGCGCAACATCGAGAGTAGAGTAGCGATGAGTCCCTGCTGAT

Full Affymetrix probeset data:

Annotations for 1633102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720