FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633103_at:

>probe:Drosophila_2:1633103_at:12:447; Interrogation_Position=143; Antisense; GATGCAAGGGAAATGCCTATCCACC
>probe:Drosophila_2:1633103_at:568:501; Interrogation_Position=15; Antisense; GTCGAGCACAATTTCAAACCACGGA
>probe:Drosophila_2:1633103_at:98:49; Interrogation_Position=155; Antisense; ATGCCTATCCACCAACACTAAAGAT
>probe:Drosophila_2:1633103_at:379:383; Interrogation_Position=200; Antisense; GAACTTTGATGCTCCACAAGTGCCC
>probe:Drosophila_2:1633103_at:638:567; Interrogation_Position=234; Antisense; GGCACTCCTTCAAATCAACCATTTG
>probe:Drosophila_2:1633103_at:202:307; Interrogation_Position=252; Antisense; CCATTTGATCAATTACGGAACCCTG
>probe:Drosophila_2:1633103_at:441:669; Interrogation_Position=265; Antisense; TACGGAACCCTGATCAACTGCATGA
>probe:Drosophila_2:1633103_at:81:349; Interrogation_Position=284; Antisense; GCATGAGCACCTGCAAGTTGAGCAA
>probe:Drosophila_2:1633103_at:663:199; Interrogation_Position=31; Antisense; AACCACGGAGTTATATTCGATCGGA
>probe:Drosophila_2:1633103_at:65:609; Interrogation_Position=315; Antisense; TGAGCTGAAGGAACACGTGGGAATC
>probe:Drosophila_2:1633103_at:358:517; Interrogation_Position=331; Antisense; GTGGGAATCACTAGAAACACCATTG
>probe:Drosophila_2:1633103_at:254:157; Interrogation_Position=347; Antisense; ACACCATTGGACCTGAGTGCATCAA
>probe:Drosophila_2:1633103_at:314:21; Interrogation_Position=43; Antisense; ATATTCGATCGGAAATGCCAGTGCA
>probe:Drosophila_2:1633103_at:503:13; Interrogation_Position=75; Antisense; ATCGGGAAACGACTTACAATTGCTG

Paste this into a BLAST search page for me
GATGCAAGGGAAATGCCTATCCACCGTCGAGCACAATTTCAAACCACGGAATGCCTATCCACCAACACTAAAGATGAACTTTGATGCTCCACAAGTGCCCGGCACTCCTTCAAATCAACCATTTGCCATTTGATCAATTACGGAACCCTGTACGGAACCCTGATCAACTGCATGAGCATGAGCACCTGCAAGTTGAGCAAAACCACGGAGTTATATTCGATCGGATGAGCTGAAGGAACACGTGGGAATCGTGGGAATCACTAGAAACACCATTGACACCATTGGACCTGAGTGCATCAAATATTCGATCGGAAATGCCAGTGCAATCGGGAAACGACTTACAATTGCTG

Full Affymetrix probeset data:

Annotations for 1633103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720