FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633106_at:

>probe:Drosophila_2:1633106_at:255:479; Interrogation_Position=430; Antisense; GTTTCGGACAGTTCATCAATGCCTT
>probe:Drosophila_2:1633106_at:106:715; Interrogation_Position=453; Antisense; TTCTACTACCTGTTGCTGCACGACA
>probe:Drosophila_2:1633106_at:363:395; Interrogation_Position=474; Antisense; GACAATCCCGAGCAGCTGGTTGACA
>probe:Drosophila_2:1633106_at:277:33; Interrogation_Position=502; Antisense; ATCACTATGCCGGATTGGTCGTTTA
>probe:Drosophila_2:1633106_at:539:377; Interrogation_Position=539; Antisense; GAAGCGACGTTGTACCAAGTTCTTT
>probe:Drosophila_2:1633106_at:156:125; Interrogation_Position=573; Antisense; AGCCCAGGCATGCTTGACTACATGA
>probe:Drosophila_2:1633106_at:193:417; Interrogation_Position=612; Antisense; GAGCGCTTTGACTCTCTGAAATACA
>probe:Drosophila_2:1633106_at:109:657; Interrogation_Position=686; Antisense; TAAGTGGCGCGACTTGATGATCCAG
>probe:Drosophila_2:1633106_at:56:77; Interrogation_Position=709; Antisense; AGGATCGTGCTGTCAAGTGTTTCTA
>probe:Drosophila_2:1633106_at:552:163; Interrogation_Position=756; Antisense; AAATACATGAACTCCCGGCGATCGG
>probe:Drosophila_2:1633106_at:154:523; Interrogation_Position=779; Antisense; GGGCCAGGCCGATTATAATATGCTA
>probe:Drosophila_2:1633106_at:462:277; Interrogation_Position=838; Antisense; CTACGGGATGATGGCGTTTCCACTT
>probe:Drosophila_2:1633106_at:264:721; Interrogation_Position=855; Antisense; TTCCACTTCAGCATTGTACCTTTTG
>probe:Drosophila_2:1633106_at:285:661; Interrogation_Position=893; Antisense; TAACACATGTACCTACTACGGCAGC

Paste this into a BLAST search page for me
GTTTCGGACAGTTCATCAATGCCTTTTCTACTACCTGTTGCTGCACGACAGACAATCCCGAGCAGCTGGTTGACAATCACTATGCCGGATTGGTCGTTTAGAAGCGACGTTGTACCAAGTTCTTTAGCCCAGGCATGCTTGACTACATGAGAGCGCTTTGACTCTCTGAAATACATAAGTGGCGCGACTTGATGATCCAGAGGATCGTGCTGTCAAGTGTTTCTAAAATACATGAACTCCCGGCGATCGGGGGCCAGGCCGATTATAATATGCTACTACGGGATGATGGCGTTTCCACTTTTCCACTTCAGCATTGTACCTTTTGTAACACATGTACCTACTACGGCAGC

Full Affymetrix probeset data:

Annotations for 1633106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720