Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633108_at:

>probe:Drosophila_2:1633108_at:117:449; Interrogation_Position=1933; Antisense; GATCCAGGCGATGTCATTACGCATA
>probe:Drosophila_2:1633108_at:214:407; Interrogation_Position=1988; Antisense; GACTGGGCCCTGATGGAACCTATGG
>probe:Drosophila_2:1633108_at:57:381; Interrogation_Position=2003; Antisense; GAACCTATGGACTGTTTCCGGCAAA
>probe:Drosophila_2:1633108_at:325:695; Interrogation_Position=2017; Antisense; TTTCCGGCAAACTATGTCGAGATCA
>probe:Drosophila_2:1633108_at:709:81; Interrogation_Position=2048; Antisense; AGGGAAACCCAAGTGCCAAGCAGCT
>probe:Drosophila_2:1633108_at:242:553; Interrogation_Position=2074; Antisense; GGACGCCCTTTTGCTAAATATCTAC
>probe:Drosophila_2:1633108_at:102:359; Interrogation_Position=2112; Antisense; GCAACTATATTTTGGATCCGGACTA
>probe:Drosophila_2:1633108_at:325:461; Interrogation_Position=2224; Antisense; GATTTTTATCGTACATCACGCGTCT
>probe:Drosophila_2:1633108_at:537:271; Interrogation_Position=2237; Antisense; CATCACGCGTCTGTTTTTTATCTAC
>probe:Drosophila_2:1633108_at:388:49; Interrogation_Position=2290; Antisense; ATGCCACATATGCAACCCTATCATA
>probe:Drosophila_2:1633108_at:205:307; Interrogation_Position=2306; Antisense; CCTATCATACGTTGTTCCCATTTGT
>probe:Drosophila_2:1633108_at:349:123; Interrogation_Position=2367; Antisense; AGCCGTGTTGCGTCCTTTTAAAATG
>probe:Drosophila_2:1633108_at:84:707; Interrogation_Position=2419; Antisense; TTAGTCAGTATTTAAGGCCCGCTCC
>probe:Drosophila_2:1633108_at:203:301; Interrogation_Position=2447; Antisense; CCCGATCCAGGGTTCTTTTGTATAT

Paste this into a BLAST search page for me
GATCCAGGCGATGTCATTACGCATAGACTGGGCCCTGATGGAACCTATGGGAACCTATGGACTGTTTCCGGCAAATTTCCGGCAAACTATGTCGAGATCAAGGGAAACCCAAGTGCCAAGCAGCTGGACGCCCTTTTGCTAAATATCTACGCAACTATATTTTGGATCCGGACTAGATTTTTATCGTACATCACGCGTCTCATCACGCGTCTGTTTTTTATCTACATGCCACATATGCAACCCTATCATACCTATCATACGTTGTTCCCATTTGTAGCCGTGTTGCGTCCTTTTAAAATGTTAGTCAGTATTTAAGGCCCGCTCCCCCGATCCAGGGTTCTTTTGTATAT

Full Affymetrix probeset data:

Annotations for 1633108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime