FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633109_at:

>probe:Drosophila_2:1633109_at:539:335; Interrogation_Position=232; Antisense; GCTCCTCGCACGTTAATGGCAACGA
>probe:Drosophila_2:1633109_at:269:389; Interrogation_Position=281; Antisense; GAAACTACGTCGCAGTGGGTCACTG
>probe:Drosophila_2:1633109_at:314:593; Interrogation_Position=296; Antisense; TGGGTCACTGAATGAATCCGCGTCC
>probe:Drosophila_2:1633109_at:173:263; Interrogation_Position=314; Antisense; CGCGTCCCGGTAGCAACAATAGTTC
>probe:Drosophila_2:1633109_at:567:375; Interrogation_Position=361; Antisense; GAAGAATCCCGAACACGATCGTCGC
>probe:Drosophila_2:1633109_at:138:349; Interrogation_Position=384; Antisense; GCAGTGACGATGACGTTGCGTTGTA
>probe:Drosophila_2:1633109_at:630:607; Interrogation_Position=416; Antisense; TGAGTGAGTCTCAACGTCTGTCCGA
>probe:Drosophila_2:1633109_at:55:607; Interrogation_Position=467; Antisense; TGAGTTCCGCAAACCAGCCGATGGC
>probe:Drosophila_2:1633109_at:470:125; Interrogation_Position=482; Antisense; AGCCGATGGCCGATTCTACACAGAT
>probe:Drosophila_2:1633109_at:625:11; Interrogation_Position=494; Antisense; ATTCTACACAGATCGCCGGAGCAGG
>probe:Drosophila_2:1633109_at:651:231; Interrogation_Position=559; Antisense; CAATGCCCATGCAATTCAGTCGCAG
>probe:Drosophila_2:1633109_at:88:649; Interrogation_Position=574; Antisense; TCAGTCGCAGCGGACAGAACATTGG
>probe:Drosophila_2:1633109_at:252:635; Interrogation_Position=634; Antisense; TCGCATCAGCTTACCTGCGTTTGAA
>probe:Drosophila_2:1633109_at:413:703; Interrogation_Position=644; Antisense; TTACCTGCGTTTGAAGCTCTCGTGC

Paste this into a BLAST search page for me
GCTCCTCGCACGTTAATGGCAACGAGAAACTACGTCGCAGTGGGTCACTGTGGGTCACTGAATGAATCCGCGTCCCGCGTCCCGGTAGCAACAATAGTTCGAAGAATCCCGAACACGATCGTCGCGCAGTGACGATGACGTTGCGTTGTATGAGTGAGTCTCAACGTCTGTCCGATGAGTTCCGCAAACCAGCCGATGGCAGCCGATGGCCGATTCTACACAGATATTCTACACAGATCGCCGGAGCAGGCAATGCCCATGCAATTCAGTCGCAGTCAGTCGCAGCGGACAGAACATTGGTCGCATCAGCTTACCTGCGTTTGAATTACCTGCGTTTGAAGCTCTCGTGC

Full Affymetrix probeset data:

Annotations for 1633109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720