FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633110_at:

>probe:Drosophila_2:1633110_at:31:19; Interrogation_Position=1014; Antisense; ATTTCCCTATTCCAACGACATTGTC
>probe:Drosophila_2:1633110_at:328:401; Interrogation_Position=1030; Antisense; GACATTGTCGTGCTCAAGGCCTTGG
>probe:Drosophila_2:1633110_at:703:713; Interrogation_Position=1051; Antisense; TTGGCTCCCATTCAACAGGGCGAAG
>probe:Drosophila_2:1633110_at:596:213; Interrogation_Position=1073; Antisense; AAGAGATCTGCATCTCCTACCTGGA
>probe:Drosophila_2:1633110_at:576:231; Interrogation_Position=1100; Antisense; AATGCATGCTGGAGCGTAGTCGCCA
>probe:Drosophila_2:1633110_at:485:223; Interrogation_Position=1135; Antisense; AAGGTCTTGCGCGAGAACTACGTGT
>probe:Drosophila_2:1633110_at:305:385; Interrogation_Position=1149; Antisense; GAACTACGTGTTCATCTGCCAGTGC
>probe:Drosophila_2:1633110_at:476:447; Interrogation_Position=1198; Antisense; GATCCCGACGAGACCAGCGAAGATG
>probe:Drosophila_2:1633110_at:669:185; Interrogation_Position=810; Antisense; AACAAGCGTGCTTTCCCAGTGGGTT
>probe:Drosophila_2:1633110_at:70:593; Interrogation_Position=829; Antisense; TGGGTTGCCAAGGTGTCCGATCTAC
>probe:Drosophila_2:1633110_at:664:441; Interrogation_Position=847; Antisense; GATCTACCACTAACGGATTCGGAAA
>probe:Drosophila_2:1633110_at:585:169; Interrogation_Position=870; Antisense; AAAGGAACAGCTCGACACGGTCATC
>probe:Drosophila_2:1633110_at:718:645; Interrogation_Position=890; Antisense; TCATCGACGGACTGTACGCCAAAGT
>probe:Drosophila_2:1633110_at:396:199; Interrogation_Position=943; Antisense; AACGAGGGCTCTGGACTATACCTGC

Paste this into a BLAST search page for me
ATTTCCCTATTCCAACGACATTGTCGACATTGTCGTGCTCAAGGCCTTGGTTGGCTCCCATTCAACAGGGCGAAGAAGAGATCTGCATCTCCTACCTGGAAATGCATGCTGGAGCGTAGTCGCCAAAGGTCTTGCGCGAGAACTACGTGTGAACTACGTGTTCATCTGCCAGTGCGATCCCGACGAGACCAGCGAAGATGAACAAGCGTGCTTTCCCAGTGGGTTTGGGTTGCCAAGGTGTCCGATCTACGATCTACCACTAACGGATTCGGAAAAAAGGAACAGCTCGACACGGTCATCTCATCGACGGACTGTACGCCAAAGTAACGAGGGCTCTGGACTATACCTGC

Full Affymetrix probeset data:

Annotations for 1633110_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720