FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633111_at:

>probe:Drosophila_2:1633111_at:81:393; Interrogation_Position=1000; Antisense; GAAACCATCGGTTCGGCGTGGGAAT
>probe:Drosophila_2:1633111_at:313:3; Interrogation_Position=546; Antisense; ATTGGACTGAACTCGGAGCCGATAC
>probe:Drosophila_2:1633111_at:91:417; Interrogation_Position=561; Antisense; GAGCCGATACTCAACTGTTCGCTGG
>probe:Drosophila_2:1633111_at:580:143; Interrogation_Position=574; Antisense; ACTGTTCGCTGGTTGTGGGCCACAA
>probe:Drosophila_2:1633111_at:61:593; Interrogation_Position=616; Antisense; TGGGCACCGAATTTGACGTTGGCAA
>probe:Drosophila_2:1633111_at:84:465; Interrogation_Position=633; Antisense; GTTGGCAACACCGAACTCAAGGGCT
>probe:Drosophila_2:1633111_at:627:225; Interrogation_Position=659; Antisense; GAAGGTGGCCCTTGGTTGGACAAAT
>probe:Drosophila_2:1633111_at:672:613; Interrogation_Position=709; Antisense; TGAAGAACGGCGACACCTGGTTGGC
>probe:Drosophila_2:1633111_at:190:589; Interrogation_Position=726; Antisense; TGGTTGGCCTCGCTGTTCTACAAGG
>probe:Drosophila_2:1633111_at:658:441; Interrogation_Position=834; Antisense; GATGTGGTCGTCAATCTGGGCATGA
>probe:Drosophila_2:1633111_at:202:595; Interrogation_Position=850; Antisense; TGGGCATGATCTACCACTTGGAGGA
>probe:Drosophila_2:1633111_at:168:651; Interrogation_Position=898; Antisense; TCAACAACCTGGTGGAGCTGGGCCT
>probe:Drosophila_2:1633111_at:44:613; Interrogation_Position=929; Antisense; TGAACAGAAACTGCGCGACGGCATC
>probe:Drosophila_2:1633111_at:539:23; Interrogation_Position=963; Antisense; ATATCCGCCGTGCTGGATTGCAACA

Paste this into a BLAST search page for me
GAAACCATCGGTTCGGCGTGGGAATATTGGACTGAACTCGGAGCCGATACGAGCCGATACTCAACTGTTCGCTGGACTGTTCGCTGGTTGTGGGCCACAATGGGCACCGAATTTGACGTTGGCAAGTTGGCAACACCGAACTCAAGGGCTGAAGGTGGCCCTTGGTTGGACAAATTGAAGAACGGCGACACCTGGTTGGCTGGTTGGCCTCGCTGTTCTACAAGGGATGTGGTCGTCAATCTGGGCATGATGGGCATGATCTACCACTTGGAGGATCAACAACCTGGTGGAGCTGGGCCTTGAACAGAAACTGCGCGACGGCATCATATCCGCCGTGCTGGATTGCAACA

Full Affymetrix probeset data:

Annotations for 1633111_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720