Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633112_at:

>probe:Drosophila_2:1633112_at:558:505; Interrogation_Position=2379; Antisense; GTGCCATCGATTACCTTTAGTTTCC
>probe:Drosophila_2:1633112_at:348:695; Interrogation_Position=2473; Antisense; TTTTACCCAACTATACTGATCGCTA
>probe:Drosophila_2:1633112_at:503:255; Interrogation_Position=2521; Antisense; CATTTTACTTTTGAGTGCCCCTCTA
>probe:Drosophila_2:1633112_at:445:695; Interrogation_Position=2548; Antisense; TTTCGCCCTAATATTCTTATTCCGC
>probe:Drosophila_2:1633112_at:716:689; Interrogation_Position=2565; Antisense; TATTCCGCCCTATATTGCATAAGCC
>probe:Drosophila_2:1633112_at:665:335; Interrogation_Position=2581; Antisense; GCATAAGCCTAAGCCTGGATTTTTA
>probe:Drosophila_2:1633112_at:111:15; Interrogation_Position=2665; Antisense; ATTTATGGTCGCTCACGCTTAGTAT
>probe:Drosophila_2:1633112_at:626:301; Interrogation_Position=2694; Antisense; CCCTTTTCTTTCTACCTTATATGCT
>probe:Drosophila_2:1633112_at:671:703; Interrogation_Position=2710; Antisense; TTATATGCTAACTTCTACCCCTTAA
>probe:Drosophila_2:1633112_at:504:657; Interrogation_Position=2725; Antisense; TACCCCTTAAAGACACCAGATCGTG
>probe:Drosophila_2:1633112_at:615:521; Interrogation_Position=2747; Antisense; GTGGCTCTGCACGACTGTAATTCTA
>probe:Drosophila_2:1633112_at:448:247; Interrogation_Position=2794; Antisense; AATTGTTTATCCACTACTCTCAGCA
>probe:Drosophila_2:1633112_at:68:631; Interrogation_Position=2826; Antisense; TCCATTCCAACGTAGGCCTGTGTAA
>probe:Drosophila_2:1633112_at:70:613; Interrogation_Position=2852; Antisense; TGAACCTATTGTTAGTCCCATCACG

Paste this into a BLAST search page for me
GTGCCATCGATTACCTTTAGTTTCCTTTTACCCAACTATACTGATCGCTACATTTTACTTTTGAGTGCCCCTCTATTTCGCCCTAATATTCTTATTCCGCTATTCCGCCCTATATTGCATAAGCCGCATAAGCCTAAGCCTGGATTTTTAATTTATGGTCGCTCACGCTTAGTATCCCTTTTCTTTCTACCTTATATGCTTTATATGCTAACTTCTACCCCTTAATACCCCTTAAAGACACCAGATCGTGGTGGCTCTGCACGACTGTAATTCTAAATTGTTTATCCACTACTCTCAGCATCCATTCCAACGTAGGCCTGTGTAATGAACCTATTGTTAGTCCCATCACG

Full Affymetrix probeset data:

Annotations for 1633112_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime