FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633117_at:

>probe:Drosophila_2:1633117_at:306:601; Interrogation_Position=260; Antisense; TGTTCAGCTGAAGTTGGCCAATTGG
>probe:Drosophila_2:1633117_at:195:507; Interrogation_Position=370; Antisense; GTGCCGCCGAAGTCATGTTGCATGA
>probe:Drosophila_2:1633117_at:515:551; Interrogation_Position=407; Antisense; GGAGAAACGACAACGCCTTGCAGAA
>probe:Drosophila_2:1633117_at:401:329; Interrogation_Position=441; Antisense; GCGGCATTGCGGCAGGAACAACTTT
>probe:Drosophila_2:1633117_at:396:155; Interrogation_Position=506; Antisense; ACAGATCGGCGATGGCATAGTTCAG
>probe:Drosophila_2:1633117_at:545:535; Interrogation_Position=530; Antisense; GGTGCCGCAGAAAATGATCCTATAT
>probe:Drosophila_2:1633117_at:661:231; Interrogation_Position=542; Antisense; AATGATCCTATATTCGCTGTACGAG
>probe:Drosophila_2:1633117_at:290:477; Interrogation_Position=597; Antisense; GTTATTATCGATGCCTATCAACAGC
>probe:Drosophila_2:1633117_at:206:189; Interrogation_Position=616; Antisense; AACAGCGATTGACCCACATGGAGAG
>probe:Drosophila_2:1633117_at:294:545; Interrogation_Position=664; Antisense; GGATCGACGAACTTCTAATGCAGAT
>probe:Drosophila_2:1633117_at:110:419; Interrogation_Position=709; Antisense; GAGCTACTAGCAACGCAACCAATTG
>probe:Drosophila_2:1633117_at:515:127; Interrogation_Position=726; Antisense; ACCAATTGTTTCTTTGCTTACGATG
>probe:Drosophila_2:1633117_at:99:377; Interrogation_Position=770; Antisense; GAAGCATATAAGTCCTACGCAAGCA
>probe:Drosophila_2:1633117_at:194:41; Interrogation_Position=808; Antisense; ATCTGGATGCGGACGGCTTTAACAT

Paste this into a BLAST search page for me
TGTTCAGCTGAAGTTGGCCAATTGGGTGCCGCCGAAGTCATGTTGCATGAGGAGAAACGACAACGCCTTGCAGAAGCGGCATTGCGGCAGGAACAACTTTACAGATCGGCGATGGCATAGTTCAGGGTGCCGCAGAAAATGATCCTATATAATGATCCTATATTCGCTGTACGAGGTTATTATCGATGCCTATCAACAGCAACAGCGATTGACCCACATGGAGAGGGATCGACGAACTTCTAATGCAGATGAGCTACTAGCAACGCAACCAATTGACCAATTGTTTCTTTGCTTACGATGGAAGCATATAAGTCCTACGCAAGCAATCTGGATGCGGACGGCTTTAACAT

Full Affymetrix probeset data:

Annotations for 1633117_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720