FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633118_at:

>probe:Drosophila_2:1633118_at:682:597; Interrogation_Position=438; Antisense; TGTCACCTGGGTGCTGCAGAATGCC
>probe:Drosophila_2:1633118_at:263:369; Interrogation_Position=456; Antisense; GAATGCCCACGGGTGGACCACAAAG
>probe:Drosophila_2:1633118_at:540:395; Interrogation_Position=480; Antisense; GAAATCGGCCCAGGCGCAAATCAAG
>probe:Drosophila_2:1633118_at:67:107; Interrogation_Position=508; Antisense; AGACATCGACGTGAGCTCTATGGCC
>probe:Drosophila_2:1633118_at:313:277; Interrogation_Position=525; Antisense; CTATGGCCGCCTGGAGACAATGATA
>probe:Drosophila_2:1633118_at:93:557; Interrogation_Position=568; Antisense; GGACGTGACTGCATCTTGAGAACCC
>probe:Drosophila_2:1633118_at:361:699; Interrogation_Position=583; Antisense; TTGAGAACCCTCTGCGAAAGTCGTC
>probe:Drosophila_2:1633118_at:510:393; Interrogation_Position=598; Antisense; GAAAGTCGTCAATACTTCCAGCGCA
>probe:Drosophila_2:1633118_at:175:99; Interrogation_Position=644; Antisense; AGATGCTTCGCACCATATTCAGCTT
>probe:Drosophila_2:1633118_at:296:17; Interrogation_Position=682; Antisense; ATTTTCACACGGGAACTGCACGAGA
>probe:Drosophila_2:1633118_at:58:457; Interrogation_Position=712; Antisense; GATATAGTGCACTACGATCAGGCAT
>probe:Drosophila_2:1633118_at:454:563; Interrogation_Position=740; Antisense; GGAATGCTCATACCGACGACTGCAC
>probe:Drosophila_2:1633118_at:137:405; Interrogation_Position=757; Antisense; GACTGCACCCAGTACAATTGTCATT
>probe:Drosophila_2:1633118_at:444:247; Interrogation_Position=772; Antisense; AATTGTCATTTCTCTTTGCTGGAAC

Paste this into a BLAST search page for me
TGTCACCTGGGTGCTGCAGAATGCCGAATGCCCACGGGTGGACCACAAAGGAAATCGGCCCAGGCGCAAATCAAGAGACATCGACGTGAGCTCTATGGCCCTATGGCCGCCTGGAGACAATGATAGGACGTGACTGCATCTTGAGAACCCTTGAGAACCCTCTGCGAAAGTCGTCGAAAGTCGTCAATACTTCCAGCGCAAGATGCTTCGCACCATATTCAGCTTATTTTCACACGGGAACTGCACGAGAGATATAGTGCACTACGATCAGGCATGGAATGCTCATACCGACGACTGCACGACTGCACCCAGTACAATTGTCATTAATTGTCATTTCTCTTTGCTGGAAC

Full Affymetrix probeset data:

Annotations for 1633118_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720