Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633124_at:

>probe:Drosophila_2:1633124_at:311:309; Interrogation_Position=4073; Antisense; TTAACCGGGCTGATGTGGAAACCAC
>probe:Drosophila_2:1633124_at:143:421; Interrogation_Position=4120; Antisense; GAGCAACCCACTGCTAGTGCGTTGA
>probe:Drosophila_2:1633124_at:278:613; Interrogation_Position=4161; Antisense; TGAAATGGACAGCTTCCAGCCACAA
>probe:Drosophila_2:1633124_at:11:685; Interrogation_Position=4210; Antisense; TATCCACCGGGCTACAAACATGTTG
>probe:Drosophila_2:1633124_at:261:237; Interrogation_Position=4290; Antisense; AATCGCATTGCCACTGATGGGCACA
>probe:Drosophila_2:1633124_at:582:525; Interrogation_Position=4308; Antisense; GGGCACAACAGCAAAACCTTCGACG
>probe:Drosophila_2:1633124_at:147:487; Interrogation_Position=4355; Antisense; GTAGCAGTAGTTCCACCTCAACATC
>probe:Drosophila_2:1633124_at:648:135; Interrogation_Position=4423; Antisense; ACGAAGTCGGATGTCACACTGGCCA
>probe:Drosophila_2:1633124_at:248:175; Interrogation_Position=4453; Antisense; AAAGCGCCGGCAATCAGCACGAAGC
>probe:Drosophila_2:1633124_at:690:371; Interrogation_Position=4491; Antisense; GAAGTCCACCTTTGAGACGAGTCTG
>probe:Drosophila_2:1633124_at:177:289; Interrogation_Position=4517; Antisense; CGGCCTTGCTCTTCGGAGACGAGGA
>probe:Drosophila_2:1633124_at:321:665; Interrogation_Position=4574; Antisense; TACCGAAGGCCCAGGTTGGACCTAG
>probe:Drosophila_2:1633124_at:128:729; Interrogation_Position=4589; Antisense; TTGGACCTAGAAATGTGCCCCGAAT
>probe:Drosophila_2:1633124_at:224:503; Interrogation_Position=4616; Antisense; GTCCCCGAAGTCTGACGTTGAGCTA

Paste this into a BLAST search page for me
TTAACCGGGCTGATGTGGAAACCACGAGCAACCCACTGCTAGTGCGTTGATGAAATGGACAGCTTCCAGCCACAATATCCACCGGGCTACAAACATGTTGAATCGCATTGCCACTGATGGGCACAGGGCACAACAGCAAAACCTTCGACGGTAGCAGTAGTTCCACCTCAACATCACGAAGTCGGATGTCACACTGGCCAAAAGCGCCGGCAATCAGCACGAAGCGAAGTCCACCTTTGAGACGAGTCTGCGGCCTTGCTCTTCGGAGACGAGGATACCGAAGGCCCAGGTTGGACCTAGTTGGACCTAGAAATGTGCCCCGAATGTCCCCGAAGTCTGACGTTGAGCTA

Full Affymetrix probeset data:

Annotations for 1633124_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime