FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633126_at:

>probe:Drosophila_2:1633126_at:470:495; Interrogation_Position=1775; Antisense; GTCAGTCAAAAGTAGCAATTGCTCA
>probe:Drosophila_2:1633126_at:612:659; Interrogation_Position=1849; Antisense; TAACCCCACTTAACCAAATCATCGT
>probe:Drosophila_2:1633126_at:389:387; Interrogation_Position=1880; Antisense; GAAAATAGTTTACCGCATTAGCTGC
>probe:Drosophila_2:1633126_at:234:297; Interrogation_Position=1893; Antisense; CGCATTAGCTGCTTGCTTATCTCAA
>probe:Drosophila_2:1633126_at:696:343; Interrogation_Position=1903; Antisense; GCTTGCTTATCTCAAATCCATCCAA
>probe:Drosophila_2:1633126_at:485:177; Interrogation_Position=1975; Antisense; AAACTGTTGTAGATGGGCACTTGCC
>probe:Drosophila_2:1633126_at:614:565; Interrogation_Position=1990; Antisense; GGCACTTGCCTACGAACTTGAAACT
>probe:Drosophila_2:1633126_at:7:725; Interrogation_Position=2007; Antisense; TTGAAACTCAGCTTTCCTTTCCTAT
>probe:Drosophila_2:1633126_at:466:261; Interrogation_Position=2015; Antisense; CAGCTTTCCTTTCCTATAACTCAAA
>probe:Drosophila_2:1633126_at:79:31; Interrogation_Position=2120; Antisense; ATAAAACAGCCAACTTAATGCGCAG
>probe:Drosophila_2:1633126_at:278:657; Interrogation_Position=2135; Antisense; TAATGCGCAGTTGACGTGATGGAAA
>probe:Drosophila_2:1633126_at:351:351; Interrogation_Position=2214; Antisense; GCAGCAAAGCCACACGGACATTTAT
>probe:Drosophila_2:1633126_at:301:127; Interrogation_Position=2221; Antisense; AGCCACACGGACATTTATACACATA
>probe:Drosophila_2:1633126_at:424:379; Interrogation_Position=2290; Antisense; GAACCCGAATATCAAACACTTATTG

Paste this into a BLAST search page for me
GTCAGTCAAAAGTAGCAATTGCTCATAACCCCACTTAACCAAATCATCGTGAAAATAGTTTACCGCATTAGCTGCCGCATTAGCTGCTTGCTTATCTCAAGCTTGCTTATCTCAAATCCATCCAAAAACTGTTGTAGATGGGCACTTGCCGGCACTTGCCTACGAACTTGAAACTTTGAAACTCAGCTTTCCTTTCCTATCAGCTTTCCTTTCCTATAACTCAAAATAAAACAGCCAACTTAATGCGCAGTAATGCGCAGTTGACGTGATGGAAAGCAGCAAAGCCACACGGACATTTATAGCCACACGGACATTTATACACATAGAACCCGAATATCAAACACTTATTG

Full Affymetrix probeset data:

Annotations for 1633126_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720