FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633128_at:

>probe:Drosophila_2:1633128_at:58:69; Interrogation_Position=13; Antisense; ATGGCCCATGAGTTGATTACGACGC
>probe:Drosophila_2:1633128_at:380:435; Interrogation_Position=132; Antisense; GAGGTGCGAATATCCAGCCGAGTAT
>probe:Drosophila_2:1633128_at:474:391; Interrogation_Position=175; Antisense; GAAACCGAAGCTATGGCCAGCCTGA
>probe:Drosophila_2:1633128_at:502:531; Interrogation_Position=210; Antisense; GGGTCCCAATATCTGCAACTGTAGT
>probe:Drosophila_2:1633128_at:529:585; Interrogation_Position=253; Antisense; TGGACAAGACATTCGATCACCGCCG
>probe:Drosophila_2:1633128_at:626:397; Interrogation_Position=280; Antisense; GACACGATGACTCGTCTGGCTTTAA
>probe:Drosophila_2:1633128_at:189:489; Interrogation_Position=306; Antisense; GTACGACACGAGCATTGGGCGCATA
>probe:Drosophila_2:1633128_at:480:355; Interrogation_Position=36; Antisense; GCACTGGCGGCGATATGTATGGCAA
>probe:Drosophila_2:1633128_at:113:531; Interrogation_Position=386; Antisense; GGGTGCCCATTCCAAACAGTCAGTT
>probe:Drosophila_2:1633128_at:665:393; Interrogation_Position=445; Antisense; GAAAGTCCGGAGATCTCTATCAGAA
>probe:Drosophila_2:1633128_at:251:627; Interrogation_Position=485; Antisense; TGCCGTCACATTTTTATCGCCAAAG
>probe:Drosophila_2:1633128_at:521:233; Interrogation_Position=523; Antisense; AATCCTTTTGCTTGCGATGACGATC
>probe:Drosophila_2:1633128_at:157:47; Interrogation_Position=545; Antisense; ATCCGCTGCTGGTCATCACAGATAT
>probe:Drosophila_2:1633128_at:95:321; Interrogation_Position=88; Antisense; GCCCGCAGACAGACATTCGTTGACA

Paste this into a BLAST search page for me
ATGGCCCATGAGTTGATTACGACGCGAGGTGCGAATATCCAGCCGAGTATGAAACCGAAGCTATGGCCAGCCTGAGGGTCCCAATATCTGCAACTGTAGTTGGACAAGACATTCGATCACCGCCGGACACGATGACTCGTCTGGCTTTAAGTACGACACGAGCATTGGGCGCATAGCACTGGCGGCGATATGTATGGCAAGGGTGCCCATTCCAAACAGTCAGTTGAAAGTCCGGAGATCTCTATCAGAATGCCGTCACATTTTTATCGCCAAAGAATCCTTTTGCTTGCGATGACGATCATCCGCTGCTGGTCATCACAGATATGCCCGCAGACAGACATTCGTTGACA

Full Affymetrix probeset data:

Annotations for 1633128_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720