FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633129_at:

>probe:Drosophila_2:1633129_at:355:421; Interrogation_Position=1811; Antisense; GAGCACATCCAGTCGTGGCATGGGT
>probe:Drosophila_2:1633129_at:222:543; Interrogation_Position=1857; Antisense; GGATTGGATGACAGAGCTCCACCAG
>probe:Drosophila_2:1633129_at:476:173; Interrogation_Position=1886; Antisense; AAAGCCCAAGTCTCAGGATGACCTG
>probe:Drosophila_2:1633129_at:387:415; Interrogation_Position=1911; Antisense; GAGCGCTCCATCGAAGCGGGTCTTA
>probe:Drosophila_2:1633129_at:153:331; Interrogation_Position=1926; Antisense; GCGGGTCTTAGATTTCTGCGTGAGA
>probe:Drosophila_2:1633129_at:101:513; Interrogation_Position=1945; Antisense; GTGAGAACTGCGACAAGGGCGTCCT
>probe:Drosophila_2:1633129_at:617:389; Interrogation_Position=1972; Antisense; GAAACAAGGCCACCTGGACGGCCAA
>probe:Drosophila_2:1633129_at:651:137; Interrogation_Position=1989; Antisense; ACGGCCAAGGCGGATTACTGAGTTA
>probe:Drosophila_2:1633129_at:33:227; Interrogation_Position=2018; Antisense; AAGGCATACCCTTCATTTATAGTTT
>probe:Drosophila_2:1633129_at:727:23; Interrogation_Position=2166; Antisense; ATAGTGCTTTCTCACAATTCCTGTC
>probe:Drosophila_2:1633129_at:354:5; Interrogation_Position=2193; Antisense; ATTTAAAAGCCCTGTGCCCAATTGC
>probe:Drosophila_2:1633129_at:433:317; Interrogation_Position=2208; Antisense; GCCCAATTGCATTCCGTCTAGGTAA
>probe:Drosophila_2:1633129_at:701:651; Interrogation_Position=2247; Antisense; TAAATTTTCCGAGAATACCCACTTG
>probe:Drosophila_2:1633129_at:503:253; Interrogation_Position=2328; Antisense; CAACGTTCTGTTTGCTCATCTAGCA

Paste this into a BLAST search page for me
GAGCACATCCAGTCGTGGCATGGGTGGATTGGATGACAGAGCTCCACCAGAAAGCCCAAGTCTCAGGATGACCTGGAGCGCTCCATCGAAGCGGGTCTTAGCGGGTCTTAGATTTCTGCGTGAGAGTGAGAACTGCGACAAGGGCGTCCTGAAACAAGGCCACCTGGACGGCCAAACGGCCAAGGCGGATTACTGAGTTAAAGGCATACCCTTCATTTATAGTTTATAGTGCTTTCTCACAATTCCTGTCATTTAAAAGCCCTGTGCCCAATTGCGCCCAATTGCATTCCGTCTAGGTAATAAATTTTCCGAGAATACCCACTTGCAACGTTCTGTTTGCTCATCTAGCA

Full Affymetrix probeset data:

Annotations for 1633129_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720