FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633134_at:

>probe:Drosophila_2:1633134_at:666:501; Interrogation_Position=104; Antisense; GTCGAGATATCAGCATGCCATCCAA
>probe:Drosophila_2:1633134_at:31:75; Interrogation_Position=139; Antisense; AGGACAAGTGCTTCGATCAGGATCA
>probe:Drosophila_2:1633134_at:428:21; Interrogation_Position=183; Antisense; ATATATGTCCTCTTCTTCGCGAAAA
>probe:Drosophila_2:1633134_at:627:417; Interrogation_Position=219; Antisense; GAGCGGCCGACACGATCAGTTGAAA
>probe:Drosophila_2:1633134_at:714:295; Interrogation_Position=248; Antisense; CGAAGAATGCTCAACACGACGATGT
>probe:Drosophila_2:1633134_at:378:409; Interrogation_Position=265; Antisense; GACGATGTCGTCTGTCCAATGCAAG
>probe:Drosophila_2:1633134_at:484:89; Interrogation_Position=292; Antisense; AGTAGGAAGCCCATCGAGGAGCCCA
>probe:Drosophila_2:1633134_at:371:141; Interrogation_Position=316; Antisense; ACTGTTCGGGATTCGCCACAAATGC
>probe:Drosophila_2:1633134_at:520:73; Interrogation_Position=353; Antisense; AGGAAGTGCGTCAGCGAAAGCTCAA
>probe:Drosophila_2:1633134_at:384:123; Interrogation_Position=417; Antisense; AGCGATGTCCCATGTGTGTCCGGAT
>probe:Drosophila_2:1633134_at:462:529; Interrogation_Position=536; Antisense; GGGATCTCACCTGGCTGTGGAACTC
>probe:Drosophila_2:1633134_at:680:23; Interrogation_Position=570; Antisense; ATATCCTCACTCTGCACTTAGTTGT
>probe:Drosophila_2:1633134_at:91:447; Interrogation_Position=596; Antisense; GATGCAGCAGAGGTGTCTCCAGCCA
>probe:Drosophila_2:1633134_at:247:499; Interrogation_Position=610; Antisense; GTCTCCAGCCACTTGGAAACTTTAA

Paste this into a BLAST search page for me
GTCGAGATATCAGCATGCCATCCAAAGGACAAGTGCTTCGATCAGGATCAATATATGTCCTCTTCTTCGCGAAAAGAGCGGCCGACACGATCAGTTGAAACGAAGAATGCTCAACACGACGATGTGACGATGTCGTCTGTCCAATGCAAGAGTAGGAAGCCCATCGAGGAGCCCAACTGTTCGGGATTCGCCACAAATGCAGGAAGTGCGTCAGCGAAAGCTCAAAGCGATGTCCCATGTGTGTCCGGATGGGATCTCACCTGGCTGTGGAACTCATATCCTCACTCTGCACTTAGTTGTGATGCAGCAGAGGTGTCTCCAGCCAGTCTCCAGCCACTTGGAAACTTTAA

Full Affymetrix probeset data:

Annotations for 1633134_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720