Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633138_at:

>probe:Drosophila_2:1633138_at:83:297; Interrogation_Position=3910; Antisense; CGCTACGAACGAGAGCAGCTTCTTT
>probe:Drosophila_2:1633138_at:221:261; Interrogation_Position=3965; Antisense; CACCGCTTTCTACGTCCGTGATAAA
>probe:Drosophila_2:1633138_at:574:491; Interrogation_Position=3995; Antisense; GTAACAATGGTAATTCGCCGGCCAT
>probe:Drosophila_2:1633138_at:477:579; Interrogation_Position=4014; Antisense; GGCCATTCGCCGACTGAACATAATT
>probe:Drosophila_2:1633138_at:105:245; Interrogation_Position=4072; Antisense; AATTCTCCATTCCTGATCTCAAAGA
>probe:Drosophila_2:1633138_at:405:109; Interrogation_Position=4115; Antisense; AGAAGAGCGCTGTTCGTGGCTCCTT
>probe:Drosophila_2:1633138_at:342:521; Interrogation_Position=4130; Antisense; GTGGCTCCTTTCTGATTCGGGACCA
>probe:Drosophila_2:1633138_at:642:349; Interrogation_Position=4155; Antisense; GCAGACGCTTTCCAAACTGGCAGGA
>probe:Drosophila_2:1633138_at:398:253; Interrogation_Position=4184; Antisense; CAAAAGGAACCTCCGGCGATGTGGA
>probe:Drosophila_2:1633138_at:426:319; Interrogation_Position=4210; Antisense; GCCGCGGAGGGCACTATTTCTGTGA
>probe:Drosophila_2:1633138_at:83:477; Interrogation_Position=4258; Antisense; GTTTTCGCCACGCTAACGGAAGAGG
>probe:Drosophila_2:1633138_at:190:127; Interrogation_Position=4370; Antisense; AGCCTCGGAGAGACAAGTGCCTAAT
>probe:Drosophila_2:1633138_at:334:87; Interrogation_Position=4385; Antisense; AGTGCCTAATAGATCAGCTCCTTTG
>probe:Drosophila_2:1633138_at:520:597; Interrogation_Position=4408; Antisense; TGATCCGTTCTTCTTTTAAGCTAAG

Paste this into a BLAST search page for me
CGCTACGAACGAGAGCAGCTTCTTTCACCGCTTTCTACGTCCGTGATAAAGTAACAATGGTAATTCGCCGGCCATGGCCATTCGCCGACTGAACATAATTAATTCTCCATTCCTGATCTCAAAGAAGAAGAGCGCTGTTCGTGGCTCCTTGTGGCTCCTTTCTGATTCGGGACCAGCAGACGCTTTCCAAACTGGCAGGACAAAAGGAACCTCCGGCGATGTGGAGCCGCGGAGGGCACTATTTCTGTGAGTTTTCGCCACGCTAACGGAAGAGGAGCCTCGGAGAGACAAGTGCCTAATAGTGCCTAATAGATCAGCTCCTTTGTGATCCGTTCTTCTTTTAAGCTAAG

Full Affymetrix probeset data:

Annotations for 1633138_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime