Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633139_at:

>probe:Drosophila_2:1633139_at:189:629; Interrogation_Position=1020; Antisense; TCAACTCGAATGTGAAGTCCCAAAA
>probe:Drosophila_2:1633139_at:277:307; Interrogation_Position=1046; Antisense; CCTTAGTATAGATTCGCCCGTTAAT
>probe:Drosophila_2:1633139_at:5:547; Interrogation_Position=543; Antisense; GGAGGGCCGTCCACTGAAGACCGTC
>probe:Drosophila_2:1633139_at:84:613; Interrogation_Position=557; Antisense; TGAAGACCGTCGTTAAGCCCGTCTC
>probe:Drosophila_2:1633139_at:385:497; Interrogation_Position=577; Antisense; GTCTCCAGCGCCAATGGTCCGAAGA
>probe:Drosophila_2:1633139_at:592:225; Interrogation_Position=589; Antisense; AATGGTCCGAAGAGGCCACACTCCG
>probe:Drosophila_2:1633139_at:147:113; Interrogation_Position=623; Antisense; AGCAGCAGGTGGTGACCATTCCCAA
>probe:Drosophila_2:1633139_at:336:9; Interrogation_Position=640; Antisense; ATTCCCAAGCCCGTCATCAAGTTTA
>probe:Drosophila_2:1633139_at:169:497; Interrogation_Position=652; Antisense; GTCATCAAGTTTACCACCACTACGA
>probe:Drosophila_2:1633139_at:278:269; Interrogation_Position=804; Antisense; CATCGCTGGCGCATCCGGTTCGGGA
>probe:Drosophila_2:1633139_at:262:35; Interrogation_Position=864; Antisense; ATCATCTGGCGTTGGAGTGGCCGTC
>probe:Drosophila_2:1633139_at:352:729; Interrogation_Position=920; Antisense; TTGTGACCAACTAGCGAAACGACAT
>probe:Drosophila_2:1633139_at:87:709; Interrogation_Position=967; Antisense; TTAAACCAGACCAAAGCACTTGCAT
>probe:Drosophila_2:1633139_at:598:355; Interrogation_Position=982; Antisense; GCACTTGCATTTGGTTGAGCGAACT

Paste this into a BLAST search page for me
TCAACTCGAATGTGAAGTCCCAAAACCTTAGTATAGATTCGCCCGTTAATGGAGGGCCGTCCACTGAAGACCGTCTGAAGACCGTCGTTAAGCCCGTCTCGTCTCCAGCGCCAATGGTCCGAAGAAATGGTCCGAAGAGGCCACACTCCGAGCAGCAGGTGGTGACCATTCCCAAATTCCCAAGCCCGTCATCAAGTTTAGTCATCAAGTTTACCACCACTACGACATCGCTGGCGCATCCGGTTCGGGAATCATCTGGCGTTGGAGTGGCCGTCTTGTGACCAACTAGCGAAACGACATTTAAACCAGACCAAAGCACTTGCATGCACTTGCATTTGGTTGAGCGAACT

Full Affymetrix probeset data:

Annotations for 1633139_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime