FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633142_at:

>probe:Drosophila_2:1633142_at:191:199; Interrogation_Position=1017; Antisense; AACGATCTTTGGTCAGCTCGACATC
>probe:Drosophila_2:1633142_at:650:705; Interrogation_Position=1119; Antisense; TTATGTGCTTGGTGCTTGAGACTGC
>probe:Drosophila_2:1633142_at:597:615; Interrogation_Position=1141; Antisense; TGCAAAGTGGATTCCTCGGTGCTTT
>probe:Drosophila_2:1633142_at:281:639; Interrogation_Position=1156; Antisense; TCGGTGCTTTGGAAGTGCTCCCAAC
>probe:Drosophila_2:1633142_at:724:235; Interrogation_Position=1232; Antisense; AATCGCAACGGATCTACAGCAGGAT
>probe:Drosophila_2:1633142_at:474:621; Interrogation_Position=1286; Antisense; TGCTGCCTGTCGTGTGTTTGAGAAA
>probe:Drosophila_2:1633142_at:6:191; Interrogation_Position=1314; Antisense; AACTTCAGGTTGATCCAGGACGAAC
>probe:Drosophila_2:1633142_at:25:555; Interrogation_Position=1331; Antisense; GGACGAACACTACTACTGGAGCATG
>probe:Drosophila_2:1633142_at:96:459; Interrogation_Position=1379; Antisense; GATATCTTGGCCCTGCGACGAATAG
>probe:Drosophila_2:1633142_at:594:495; Interrogation_Position=828; Antisense; GTCAGTGCTATCCATGAGATCCATC
>probe:Drosophila_2:1633142_at:423:585; Interrogation_Position=877; Antisense; TGGACCTCGGGCTCAACATGGATCG
>probe:Drosophila_2:1633142_at:586:271; Interrogation_Position=914; Antisense; CATTATGTACATCCTGAACCGTGAG
>probe:Drosophila_2:1633142_at:108:425; Interrogation_Position=947; Antisense; GAGACTGCAGATACAGTGCCCGGAT
>probe:Drosophila_2:1633142_at:219:489; Interrogation_Position=962; Antisense; GTGCCCGGATGGTTATTTCCTGGAC

Paste this into a BLAST search page for me
AACGATCTTTGGTCAGCTCGACATCTTATGTGCTTGGTGCTTGAGACTGCTGCAAAGTGGATTCCTCGGTGCTTTTCGGTGCTTTGGAAGTGCTCCCAACAATCGCAACGGATCTACAGCAGGATTGCTGCCTGTCGTGTGTTTGAGAAAAACTTCAGGTTGATCCAGGACGAACGGACGAACACTACTACTGGAGCATGGATATCTTGGCCCTGCGACGAATAGGTCAGTGCTATCCATGAGATCCATCTGGACCTCGGGCTCAACATGGATCGCATTATGTACATCCTGAACCGTGAGGAGACTGCAGATACAGTGCCCGGATGTGCCCGGATGGTTATTTCCTGGAC

Full Affymetrix probeset data:

Annotations for 1633142_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720