FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633144_at:

>probe:Drosophila_2:1633144_at:524:117; Interrogation_Position=8687; Antisense; AGCTGACAGTTAGGGTCCGTGGACC
>probe:Drosophila_2:1633144_at:704:517; Interrogation_Position=8705; Antisense; GTGGACCCAAAGGAGCTTTCCGCGT
>probe:Drosophila_2:1633144_at:235:117; Interrogation_Position=8718; Antisense; AGCTTTCCGCGTGGAGATGCAGCGT
>probe:Drosophila_2:1633144_at:151:427; Interrogation_Position=8743; Antisense; GAGAGTCAGAAAGATCGCACCATAC
>probe:Drosophila_2:1633144_at:603:509; Interrogation_Position=8769; Antisense; GTGCAAGTACGATCCAACCGAACCG
>probe:Drosophila_2:1633144_at:84:1; Interrogation_Position=8785; Antisense; ACCGAACCGGGTGACTATCGAGTTG
>probe:Drosophila_2:1633144_at:576:293; Interrogation_Position=8826; Antisense; CGAATTCGTGCCAGGATCGCCGTTC
>probe:Drosophila_2:1633144_at:42:305; Interrogation_Position=8852; Antisense; CCGTCATGATCTTCGACACTGAGGA
>probe:Drosophila_2:1633144_at:41:3; Interrogation_Position=8879; Antisense; AGTTACGAAGGTACTTACAGGGCAT
>probe:Drosophila_2:1633144_at:443:665; Interrogation_Position=8894; Antisense; TACAGGGCATATGAGGCCAGCTCAA
>probe:Drosophila_2:1633144_at:655:117; Interrogation_Position=8912; Antisense; AGCTCAACCACCATGTCATTGTCTT
>probe:Drosophila_2:1633144_at:200:81; Interrogation_Position=8941; Antisense; AGTGGCCTTAGTCCGCTACCAATTA
>probe:Drosophila_2:1633144_at:188:245; Interrogation_Position=8961; Antisense; AATTAGGCGCGATCAATCCCGACGA
>probe:Drosophila_2:1633144_at:88:107; Interrogation_Position=9011; Antisense; AGAAGCCCATAAAACCTTGTAGTAT

Paste this into a BLAST search page for me
AGCTGACAGTTAGGGTCCGTGGACCGTGGACCCAAAGGAGCTTTCCGCGTAGCTTTCCGCGTGGAGATGCAGCGTGAGAGTCAGAAAGATCGCACCATACGTGCAAGTACGATCCAACCGAACCGACCGAACCGGGTGACTATCGAGTTGCGAATTCGTGCCAGGATCGCCGTTCCCGTCATGATCTTCGACACTGAGGAAGTTACGAAGGTACTTACAGGGCATTACAGGGCATATGAGGCCAGCTCAAAGCTCAACCACCATGTCATTGTCTTAGTGGCCTTAGTCCGCTACCAATTAAATTAGGCGCGATCAATCCCGACGAAGAAGCCCATAAAACCTTGTAGTAT

Full Affymetrix probeset data:

Annotations for 1633144_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720