FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633145_at:

>probe:Drosophila_2:1633145_at:308:651; Interrogation_Position=1035; Antisense; TCACAGCTGTGAACCTCCAAAAGAT
>probe:Drosophila_2:1633145_at:475:351; Interrogation_Position=1060; Antisense; GCAGATGAACTAGTCGTGGCCTTTA
>probe:Drosophila_2:1633145_at:708:521; Interrogation_Position=1075; Antisense; GTGGCCTTTATTGGTCCATCGAGTA
>probe:Drosophila_2:1633145_at:247:389; Interrogation_Position=1219; Antisense; GAAACTTGGCTAGTGCCATTCCTGT
>probe:Drosophila_2:1633145_at:635:9; Interrogation_Position=1236; Antisense; ATTCCTGTGCCATTTTTCAAAGTGA
>probe:Drosophila_2:1633145_at:244:535; Interrogation_Position=1311; Antisense; GGTGACAATCTCCTTCGTATTTATA
>probe:Drosophila_2:1633145_at:650:657; Interrogation_Position=788; Antisense; TAAAGATCGTTACCCGACCCTATTG
>probe:Drosophila_2:1633145_at:226:685; Interrogation_Position=808; Antisense; TATTGGTTGGCCCAGCCACCTATAG
>probe:Drosophila_2:1633145_at:728:683; Interrogation_Position=828; Antisense; TATAGTGCCACTTACTCCTTTGAAG
>probe:Drosophila_2:1633145_at:315:425; Interrogation_Position=862; Antisense; GAGAGCGTGAGATTTGTGGCAACCA
>probe:Drosophila_2:1633145_at:69:315; Interrogation_Position=891; Antisense; GCCATCATGTTTCACTCAAGCCGAG
>probe:Drosophila_2:1633145_at:275:651; Interrogation_Position=906; Antisense; TCAAGCCGAGTGCACTTTTCGAGTG
>probe:Drosophila_2:1633145_at:190:433; Interrogation_Position=926; Antisense; GAGTGCGCCTTCTGCAAAATTGGCA
>probe:Drosophila_2:1633145_at:233:659; Interrogation_Position=978; Antisense; TAACTATAATTTCGTTGCGGCTGGG

Paste this into a BLAST search page for me
TCACAGCTGTGAACCTCCAAAAGATGCAGATGAACTAGTCGTGGCCTTTAGTGGCCTTTATTGGTCCATCGAGTAGAAACTTGGCTAGTGCCATTCCTGTATTCCTGTGCCATTTTTCAAAGTGAGGTGACAATCTCCTTCGTATTTATATAAAGATCGTTACCCGACCCTATTGTATTGGTTGGCCCAGCCACCTATAGTATAGTGCCACTTACTCCTTTGAAGGAGAGCGTGAGATTTGTGGCAACCAGCCATCATGTTTCACTCAAGCCGAGTCAAGCCGAGTGCACTTTTCGAGTGGAGTGCGCCTTCTGCAAAATTGGCATAACTATAATTTCGTTGCGGCTGGG

Full Affymetrix probeset data:

Annotations for 1633145_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720