FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633147_at:

>probe:Drosophila_2:1633147_at:578:259; Interrogation_Position=116; Antisense; CACTGTGCCAGTCTACTAGCGAGAA
>probe:Drosophila_2:1633147_at:669:481; Interrogation_Position=174; Antisense; GTATCACCTGTCGATGATTGCTCAG
>probe:Drosophila_2:1633147_at:448:647; Interrogation_Position=195; Antisense; TCAGGGCACGTGTTTGGTGGCCATC
>probe:Drosophila_2:1633147_at:30:243; Interrogation_Position=239; Antisense; AATTTGTGGGACTGGTACTTGCCGG
>probe:Drosophila_2:1633147_at:39:321; Interrogation_Position=265; Antisense; GCCCAGTATCCCGAGGACTTGGAGA
>probe:Drosophila_2:1633147_at:277:347; Interrogation_Position=291; Antisense; GCATCGCATTGAGGCGGAGTCCATG
>probe:Drosophila_2:1633147_at:220:727; Interrogation_Position=327; Antisense; TTGGGCTCGCGCATGCATAATGCTA
>probe:Drosophila_2:1633147_at:607:439; Interrogation_Position=367; Antisense; GAGGCCAACCTCTTTGAGCGTTTCG
>probe:Drosophila_2:1633147_at:267:633; Interrogation_Position=412; Antisense; TCCCACATTACCAGTGTCGAATCTT
>probe:Drosophila_2:1633147_at:387:169; Interrogation_Position=448; Antisense; AAAGGACTGGGATCACGACTGGCCG
>probe:Drosophila_2:1633147_at:127:223; Interrogation_Position=500; Antisense; AAGGATTTCCCGCAATGACGGCCTA
>probe:Drosophila_2:1633147_at:562:527; Interrogation_Position=565; Antisense; GGGATGAAGTGCGTCCATTCGCTTC
>probe:Drosophila_2:1633147_at:6:351; Interrogation_Position=637; Antisense; GCAGAACCACACACTATGGCTCGAA
>probe:Drosophila_2:1633147_at:656:191; Interrogation_Position=97; Antisense; AACTTTTTCCAATCAGAGCCACTGT

Paste this into a BLAST search page for me
CACTGTGCCAGTCTACTAGCGAGAAGTATCACCTGTCGATGATTGCTCAGTCAGGGCACGTGTTTGGTGGCCATCAATTTGTGGGACTGGTACTTGCCGGGCCCAGTATCCCGAGGACTTGGAGAGCATCGCATTGAGGCGGAGTCCATGTTGGGCTCGCGCATGCATAATGCTAGAGGCCAACCTCTTTGAGCGTTTCGTCCCACATTACCAGTGTCGAATCTTAAAGGACTGGGATCACGACTGGCCGAAGGATTTCCCGCAATGACGGCCTAGGGATGAAGTGCGTCCATTCGCTTCGCAGAACCACACACTATGGCTCGAAAACTTTTTCCAATCAGAGCCACTGT

Full Affymetrix probeset data:

Annotations for 1633147_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720