FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633149_at:

>probe:Drosophila_2:1633149_at:623:467; Interrogation_Position=172; Antisense; GTTGATGCCAGGTACTAATCCCAGT
>probe:Drosophila_2:1633149_at:163:695; Interrogation_Position=203; Antisense; TTTGCCGTCACGTTTCAGACACGGA
>probe:Drosophila_2:1633149_at:328:685; Interrogation_Position=233; Antisense; TATACGAGGAGGTCACCCGGCAAAT
>probe:Drosophila_2:1633149_at:41:317; Interrogation_Position=275; Antisense; GCCCGTATCCGGAGGAAGTGCGTTT
>probe:Drosophila_2:1633149_at:643:621; Interrogation_Position=293; Antisense; TGCGTTTCCGGGTAATGGGCACCAC
>probe:Drosophila_2:1633149_at:688:139; Interrogation_Position=316; Antisense; ACGGACCAGCGCTCGGCAGAGATAG
>probe:Drosophila_2:1633149_at:470:101; Interrogation_Position=333; Antisense; AGAGATAGCCATCACCGAGTGCCAG
>probe:Drosophila_2:1633149_at:169:425; Interrogation_Position=374; Antisense; GAGACTATCTCAAGCGGTACTCGCA
>probe:Drosophila_2:1633149_at:707:167; Interrogation_Position=398; Antisense; AAATGTGCCACGAGCGATTCCACAA
>probe:Drosophila_2:1633149_at:617:191; Interrogation_Position=420; Antisense; CAACGTACCCCTGCTGGAAGGTTAG
>probe:Drosophila_2:1633149_at:565:561; Interrogation_Position=435; Antisense; GGAAGGTTAGCACCACGACCAGAAA
>probe:Drosophila_2:1633149_at:469:179; Interrogation_Position=457; Antisense; AAAACTAATCGGCATTTCTCCCTAT
>probe:Drosophila_2:1633149_at:545:149; Interrogation_Position=486; Antisense; ACTTCTGCTTCAATTACTATCCTAC
>probe:Drosophila_2:1633149_at:143:471; Interrogation_Position=524; Antisense; GTTTGTTAATCGTGTGCTTCCTTCC

Paste this into a BLAST search page for me
GTTGATGCCAGGTACTAATCCCAGTTTTGCCGTCACGTTTCAGACACGGATATACGAGGAGGTCACCCGGCAAATGCCCGTATCCGGAGGAAGTGCGTTTTGCGTTTCCGGGTAATGGGCACCACACGGACCAGCGCTCGGCAGAGATAGAGAGATAGCCATCACCGAGTGCCAGGAGACTATCTCAAGCGGTACTCGCAAAATGTGCCACGAGCGATTCCACAACAACGTACCCCTGCTGGAAGGTTAGGGAAGGTTAGCACCACGACCAGAAAAAAACTAATCGGCATTTCTCCCTATACTTCTGCTTCAATTACTATCCTACGTTTGTTAATCGTGTGCTTCCTTCC

Full Affymetrix probeset data:

Annotations for 1633149_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720