Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633152_at:

>probe:Drosophila_2:1633152_at:279:265; Interrogation_Position=1364; Antisense; CAGAGGCTCAAGAAAAACAATTCGA
>probe:Drosophila_2:1633152_at:698:37; Interrogation_Position=1630; Antisense; ATCTTTTGGCTATGGTTATGAATTC
>probe:Drosophila_2:1633152_at:417:539; Interrogation_Position=1643; Antisense; GGTTATGAATTCCAAACAGTTTTGA
>probe:Drosophila_2:1633152_at:626:89; Interrogation_Position=1660; Antisense; AGTTTTGATTTTGTAATGCTGAAGG
>probe:Drosophila_2:1633152_at:673:331; Interrogation_Position=1677; Antisense; GCTGAAGGGAGATATCTTATAGTTT
>probe:Drosophila_2:1633152_at:404:175; Interrogation_Position=1718; Antisense; AAACCTATACCTTAGAGCTGTGCTA
>probe:Drosophila_2:1633152_at:550:677; Interrogation_Position=1730; Antisense; TAGAGCTGTGCTAGTGCTCTGCTTT
>probe:Drosophila_2:1633152_at:626:679; Interrogation_Position=1741; Antisense; TAGTGCTCTGCTTTCCATAATTGTA
>probe:Drosophila_2:1633152_at:582:337; Interrogation_Position=1745; Antisense; GCTCTGCTTTCCATAATTGTAGTTA
>probe:Drosophila_2:1633152_at:369:245; Interrogation_Position=1795; Antisense; AATTTTGATCAACTCGTTTATGTAC
>probe:Drosophila_2:1633152_at:683:453; Interrogation_Position=1801; Antisense; GATCAACTCGTTTATGTACATAAGA
>probe:Drosophila_2:1633152_at:111:559; Interrogation_Position=1838; Antisense; GGACATATTTATTCATTTTCATAGA
>probe:Drosophila_2:1633152_at:265:477; Interrogation_Position=1867; Antisense; GTTATTATAAGCATACAACTACGAA
>probe:Drosophila_2:1633152_at:544:143; Interrogation_Position=1903; Antisense; ACTGAGTTGCTGTAACGTTGAACGA

Paste this into a BLAST search page for me
CAGAGGCTCAAGAAAAACAATTCGAATCTTTTGGCTATGGTTATGAATTCGGTTATGAATTCCAAACAGTTTTGAAGTTTTGATTTTGTAATGCTGAAGGGCTGAAGGGAGATATCTTATAGTTTAAACCTATACCTTAGAGCTGTGCTATAGAGCTGTGCTAGTGCTCTGCTTTTAGTGCTCTGCTTTCCATAATTGTAGCTCTGCTTTCCATAATTGTAGTTAAATTTTGATCAACTCGTTTATGTACGATCAACTCGTTTATGTACATAAGAGGACATATTTATTCATTTTCATAGAGTTATTATAAGCATACAACTACGAAACTGAGTTGCTGTAACGTTGAACGA

Full Affymetrix probeset data:

Annotations for 1633152_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime