FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633153_at:

>probe:Drosophila_2:1633153_at:273:235; Interrogation_Position=3189; Antisense; AATCCTGCAGACACAAGCCGGCTTA
>probe:Drosophila_2:1633153_at:187:507; Interrogation_Position=3226; Antisense; GTGCCGAATTGCAGGCGATCATCGA
>probe:Drosophila_2:1633153_at:597:573; Interrogation_Position=3263; Antisense; GGCTGGTTCCGCCAAGCGAAACAAG
>probe:Drosophila_2:1633153_at:642:389; Interrogation_Position=3280; Antisense; GAAACAAGCGATCGCTGAGCTCCAC
>probe:Drosophila_2:1633153_at:99:119; Interrogation_Position=3297; Antisense; AGCTCCACACGCCTGGACAAGGACA
>probe:Drosophila_2:1633153_at:328:263; Interrogation_Position=3385; Antisense; CAGCAGCATCAGCTGTAGCCAACAG
>probe:Drosophila_2:1633153_at:56:487; Interrogation_Position=3399; Antisense; GTAGCCAACAGCACATCGATCAACG
>probe:Drosophila_2:1633153_at:422:359; Interrogation_Position=3496; Antisense; GCAACAGCGGCAGCTTCAAGCTTTC
>probe:Drosophila_2:1633153_at:251:409; Interrogation_Position=3557; Antisense; GACGTCCGCCTCAAATTCGGGTATT
>probe:Drosophila_2:1633153_at:156:189; Interrogation_Position=3619; Antisense; AACAGCACCTGGTACGCGGTGTGAG
>probe:Drosophila_2:1633153_at:114:597; Interrogation_Position=3638; Antisense; TGTGAGTCGTGCGTCCAGCGAAAAG
>probe:Drosophila_2:1633153_at:229:187; Interrogation_Position=3694; Antisense; AACAACAGTCTCTGGACCATCAACA
>probe:Drosophila_2:1633153_at:93:415; Interrogation_Position=3708; Antisense; GACCATCAACAATCCAATCTCAAGC
>probe:Drosophila_2:1633153_at:267:49; Interrogation_Position=3719; Antisense; ATCCAATCTCAAGCTGCGCAAGAAG

Paste this into a BLAST search page for me
AATCCTGCAGACACAAGCCGGCTTAGTGCCGAATTGCAGGCGATCATCGAGGCTGGTTCCGCCAAGCGAAACAAGGAAACAAGCGATCGCTGAGCTCCACAGCTCCACACGCCTGGACAAGGACACAGCAGCATCAGCTGTAGCCAACAGGTAGCCAACAGCACATCGATCAACGGCAACAGCGGCAGCTTCAAGCTTTCGACGTCCGCCTCAAATTCGGGTATTAACAGCACCTGGTACGCGGTGTGAGTGTGAGTCGTGCGTCCAGCGAAAAGAACAACAGTCTCTGGACCATCAACAGACCATCAACAATCCAATCTCAAGCATCCAATCTCAAGCTGCGCAAGAAG

Full Affymetrix probeset data:

Annotations for 1633153_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720