FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633154_at:

>probe:Drosophila_2:1633154_at:289:719; Interrogation_Position=1634; Antisense; TTCCGAATGCACATGTCCTGCCAAA
>probe:Drosophila_2:1633154_at:67:343; Interrogation_Position=1674; Antisense; GCTTATACTGCTGTACCTGATCATC
>probe:Drosophila_2:1633154_at:146:191; Interrogation_Position=1722; Antisense; AACATTTCTGCGAATGCGGCGAGTA
>probe:Drosophila_2:1633154_at:451:329; Interrogation_Position=1737; Antisense; GCGGCGAGTAATTTGCAGCTTCTTC
>probe:Drosophila_2:1633154_at:124:189; Interrogation_Position=1778; Antisense; AACAGCGCATCCTTTTCCTGTATAA
>probe:Drosophila_2:1633154_at:75:347; Interrogation_Position=1805; Antisense; GCATCCTGCGGAATCGGCTTAGATC
>probe:Drosophila_2:1633154_at:368:347; Interrogation_Position=1887; Antisense; GCAGGTCAACGTCTTCCTTTGGCTA
>probe:Drosophila_2:1633154_at:619:689; Interrogation_Position=1904; Antisense; TTTGGCTACGGTTTTCATGTCCGGT
>probe:Drosophila_2:1633154_at:90:61; Interrogation_Position=1920; Antisense; ATGTCCGGTCGCATTTGGTTGGATA
>probe:Drosophila_2:1633154_at:349:543; Interrogation_Position=1940; Antisense; GGATACGGCACTTTAAGTTCGCCAA
>probe:Drosophila_2:1633154_at:253:75; Interrogation_Position=1966; Antisense; AGGACCTGCATGATCTGCCGAGGAT
>probe:Drosophila_2:1633154_at:447:521; Interrogation_Position=2026; Antisense; GGGCTGCCATATTGCGACGATTGTG
>probe:Drosophila_2:1633154_at:291:453; Interrogation_Position=2056; Antisense; GATCTCAACAGTGTGTGCTTTCAGT
>probe:Drosophila_2:1633154_at:626:695; Interrogation_Position=2074; Antisense; TTTCAGTGCGGTGTGGTTCTTACTA

Paste this into a BLAST search page for me
TTCCGAATGCACATGTCCTGCCAAAGCTTATACTGCTGTACCTGATCATCAACATTTCTGCGAATGCGGCGAGTAGCGGCGAGTAATTTGCAGCTTCTTCAACAGCGCATCCTTTTCCTGTATAAGCATCCTGCGGAATCGGCTTAGATCGCAGGTCAACGTCTTCCTTTGGCTATTTGGCTACGGTTTTCATGTCCGGTATGTCCGGTCGCATTTGGTTGGATAGGATACGGCACTTTAAGTTCGCCAAAGGACCTGCATGATCTGCCGAGGATGGGCTGCCATATTGCGACGATTGTGGATCTCAACAGTGTGTGCTTTCAGTTTTCAGTGCGGTGTGGTTCTTACTA

Full Affymetrix probeset data:

Annotations for 1633154_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720