FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633155_at:

>probe:Drosophila_2:1633155_at:491:499; Interrogation_Position=106; Antisense; GTCGTGTTCGGACTGTTTTCGATGC
>probe:Drosophila_2:1633155_at:571:403; Interrogation_Position=116; Antisense; GACTGTTTTCGATGCTGGCCGGGAA
>probe:Drosophila_2:1633155_at:541:445; Interrogation_Position=126; Antisense; GATGCTGGCCGGGAACTGTGTCAAT
>probe:Drosophila_2:1633155_at:504:527; Interrogation_Position=136; Antisense; GGGAACTGTGTCAATGGGCATGCCA
>probe:Drosophila_2:1633155_at:189:65; Interrogation_Position=149; Antisense; ATGGGCATGCCATTTTGCAAGACGA
>probe:Drosophila_2:1633155_at:674:627; Interrogation_Position=156; Antisense; TGCCATTTTGCAAGACGAGGCCAAA
>probe:Drosophila_2:1633155_at:281:105; Interrogation_Position=168; Antisense; AGACGAGGCCAAACAGCCAGAAGAA
>probe:Drosophila_2:1633155_at:92:313; Interrogation_Position=183; Antisense; GCCAGAAGAAGTTGCAGAAGATTCG
>probe:Drosophila_2:1633155_at:271:187; Interrogation_Position=24; Antisense; AACAACAGCAGCGAACAAATCACCG
>probe:Drosophila_2:1633155_at:299:123; Interrogation_Position=33; Antisense; AGCGAACAAATCACCGCAGCAGCAG
>probe:Drosophila_2:1633155_at:284:359; Interrogation_Position=57; Antisense; GCAACACAGACGGCAGCAGCATCTT
>probe:Drosophila_2:1633155_at:373:647; Interrogation_Position=81; Antisense; TCAGTGGAGCGCCTGCATTATGATA
>probe:Drosophila_2:1633155_at:611:553; Interrogation_Position=86; Antisense; GGAGCGCCTGCATTATGATAGTCGT
>probe:Drosophila_2:1633155_at:321:315; Interrogation_Position=91; Antisense; GCCTGCATTATGATAGTCGTGTTCG

Paste this into a BLAST search page for me
GTCGTGTTCGGACTGTTTTCGATGCGACTGTTTTCGATGCTGGCCGGGAAGATGCTGGCCGGGAACTGTGTCAATGGGAACTGTGTCAATGGGCATGCCAATGGGCATGCCATTTTGCAAGACGATGCCATTTTGCAAGACGAGGCCAAAAGACGAGGCCAAACAGCCAGAAGAAGCCAGAAGAAGTTGCAGAAGATTCGAACAACAGCAGCGAACAAATCACCGAGCGAACAAATCACCGCAGCAGCAGGCAACACAGACGGCAGCAGCATCTTTCAGTGGAGCGCCTGCATTATGATAGGAGCGCCTGCATTATGATAGTCGTGCCTGCATTATGATAGTCGTGTTCG

Full Affymetrix probeset data:

Annotations for 1633155_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720