Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633156_at:

>probe:Drosophila_2:1633156_at:217:167; Interrogation_Position=1384; Antisense; AAATGCTACGACAGTTGCCGGGACG
>probe:Drosophila_2:1633156_at:157:245; Interrogation_Position=1439; Antisense; AATTATCCCGATATACCAGCTACCG
>probe:Drosophila_2:1633156_at:152:673; Interrogation_Position=1459; Antisense; TACCGTCAAAGCGTCATGTGCAGCA
>probe:Drosophila_2:1633156_at:294:71; Interrogation_Position=1490; Antisense; AGGCCCACAGTGTGCGGCAGCTGAA
>probe:Drosophila_2:1633156_at:343:109; Interrogation_Position=1529; Antisense; AGAAGCATGTGCAACTCAGGACTAA
>probe:Drosophila_2:1633156_at:108:597; Interrogation_Position=1591; Antisense; TGTCATAAGCAGCAGCGTCCTCGGG
>probe:Drosophila_2:1633156_at:710:269; Interrogation_Position=1686; Antisense; CATGCGGAATCCACAGAGCTGTTCA
>probe:Drosophila_2:1633156_at:652:49; Interrogation_Position=1721; Antisense; ATGCCATTGATGATTGCCACTCCTG
>probe:Drosophila_2:1633156_at:653:119; Interrogation_Position=1747; Antisense; AGCTGCAGCGAAGTCGAGTCCTGTT
>probe:Drosophila_2:1633156_at:657:431; Interrogation_Position=1762; Antisense; GAGTCCTGTTCCTCGGCTGGAGAAT
>probe:Drosophila_2:1633156_at:399:109; Interrogation_Position=1782; Antisense; AGAATCCTCTTCCAGCTGTTGTGCT
>probe:Drosophila_2:1633156_at:424:507; Interrogation_Position=1802; Antisense; GTGCTGCTCATTGCGAAGTTCTCGA
>probe:Drosophila_2:1633156_at:410:93; Interrogation_Position=1818; Antisense; AGTTCTCGAAACTTGTGGCCATTCC
>probe:Drosophila_2:1633156_at:132:495; Interrogation_Position=1912; Antisense; GTCAAAATGTCATTGCCCGTCTCGA

Paste this into a BLAST search page for me
AAATGCTACGACAGTTGCCGGGACGAATTATCCCGATATACCAGCTACCGTACCGTCAAAGCGTCATGTGCAGCAAGGCCCACAGTGTGCGGCAGCTGAAAGAAGCATGTGCAACTCAGGACTAATGTCATAAGCAGCAGCGTCCTCGGGCATGCGGAATCCACAGAGCTGTTCAATGCCATTGATGATTGCCACTCCTGAGCTGCAGCGAAGTCGAGTCCTGTTGAGTCCTGTTCCTCGGCTGGAGAATAGAATCCTCTTCCAGCTGTTGTGCTGTGCTGCTCATTGCGAAGTTCTCGAAGTTCTCGAAACTTGTGGCCATTCCGTCAAAATGTCATTGCCCGTCTCGA

Full Affymetrix probeset data:

Annotations for 1633156_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime