FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633158_at:

>probe:Drosophila_2:1633158_at:356:287; Interrogation_Position=1019; Antisense; CGGACTGACCTTTGTGACCATCAAG
>probe:Drosophila_2:1633158_at:498:79; Interrogation_Position=1042; Antisense; AGGGATTGGCCAGTATCTTCCTTAG
>probe:Drosophila_2:1633158_at:76:721; Interrogation_Position=1059; Antisense; TTCCTTAGCCAGTCGCAGTATCAAC
>probe:Drosophila_2:1633158_at:74:351; Interrogation_Position=1073; Antisense; GCAGTATCAACAGAGGCGCCACAGA
>probe:Drosophila_2:1633158_at:405:577; Interrogation_Position=1087; Antisense; GGCGCCACAGATTCGTCATGGACTA
>probe:Drosophila_2:1633158_at:557:41; Interrogation_Position=1123; Antisense; ATCGTATCAACTATCAGTCCCGGTA
>probe:Drosophila_2:1633158_at:638:503; Interrogation_Position=1139; Antisense; GTCCCGGTAGCGCTGAAGGCATCTA
>probe:Drosophila_2:1633158_at:87:349; Interrogation_Position=1170; Antisense; GCAGGCATCCATCAGTTACAACAAA
>probe:Drosophila_2:1633158_at:8:359; Interrogation_Position=773; Antisense; GCAACTGGATGCTGTGGGTCTACCC
>probe:Drosophila_2:1633158_at:635:315; Interrogation_Position=865; Antisense; GCCTAATTGGCGGTAACTTGGCAAC
>probe:Drosophila_2:1633158_at:51:585; Interrogation_Position=883; Antisense; TGGCAACGGAGCAACTTGGTCGCGC
>probe:Drosophila_2:1633158_at:60:309; Interrogation_Position=943; Antisense; CCATTTCCGTGGTGCTGGGACAGAA
>probe:Drosophila_2:1633158_at:409:377; Interrogation_Position=965; Antisense; GAAGCTCTTCGGCAGGATCTACGAG
>probe:Drosophila_2:1633158_at:466:217; Interrogation_Position=996; Antisense; AAGTTATTGAGCATCCTCCTGGGCG

Paste this into a BLAST search page for me
CGGACTGACCTTTGTGACCATCAAGAGGGATTGGCCAGTATCTTCCTTAGTTCCTTAGCCAGTCGCAGTATCAACGCAGTATCAACAGAGGCGCCACAGAGGCGCCACAGATTCGTCATGGACTAATCGTATCAACTATCAGTCCCGGTAGTCCCGGTAGCGCTGAAGGCATCTAGCAGGCATCCATCAGTTACAACAAAGCAACTGGATGCTGTGGGTCTACCCGCCTAATTGGCGGTAACTTGGCAACTGGCAACGGAGCAACTTGGTCGCGCCCATTTCCGTGGTGCTGGGACAGAAGAAGCTCTTCGGCAGGATCTACGAGAAGTTATTGAGCATCCTCCTGGGCG

Full Affymetrix probeset data:

Annotations for 1633158_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720