FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633159_at:

>probe:Drosophila_2:1633159_at:547:63; Interrogation_Position=128; Antisense; ATGTGAGCACTATTCTCTCCGTGGA
>probe:Drosophila_2:1633159_at:632:69; Interrogation_Position=13; Antisense; ATGGCCACATATCCATCTGCCAAAT
>probe:Drosophila_2:1633159_at:281:435; Interrogation_Position=169; Antisense; GAGGGAGTCCTAATGGCTGCACTTC
>probe:Drosophila_2:1633159_at:492:333; Interrogation_Position=184; Antisense; GCTGCACTTCTGCACGATGTCGTGG
>probe:Drosophila_2:1633159_at:154:545; Interrogation_Position=210; Antisense; GGATACGGACGCATCTTTCGAGGAT
>probe:Drosophila_2:1633159_at:361:725; Interrogation_Position=236; Antisense; TTGAGAAACTCTTTGGACCGGATGT
>probe:Drosophila_2:1633159_at:572:509; Interrogation_Position=280; Antisense; GTGACGGACGACAAGTCCCTGGAGA
>probe:Drosophila_2:1633159_at:694:279; Interrogation_Position=29; Antisense; CTGCCAAATTCATGGAGTGCCTCCA
>probe:Drosophila_2:1633159_at:676:81; Interrogation_Position=397; Antisense; AGGGATCTGCAAGTCAACACACCGA
>probe:Drosophila_2:1633159_at:627:65; Interrogation_Position=40; Antisense; ATGGAGTGCCTCCAATATGCAGCTT
>probe:Drosophila_2:1633159_at:511:153; Interrogation_Position=432; Antisense; ACAGGAGCGTCGTGATCAGTACTTC
>probe:Drosophila_2:1633159_at:400:449; Interrogation_Position=445; Antisense; GATCAGTACTTCGTTTGGGCCAAAA
>probe:Drosophila_2:1633159_at:218:327; Interrogation_Position=486; Antisense; GCGAGGAACCAACGCCAACCTGGAG
>probe:Drosophila_2:1633159_at:101:683; Interrogation_Position=55; Antisense; TATGCAGCTTTTAAGCACCGGCAGC

Paste this into a BLAST search page for me
ATGTGAGCACTATTCTCTCCGTGGAATGGCCACATATCCATCTGCCAAATGAGGGAGTCCTAATGGCTGCACTTCGCTGCACTTCTGCACGATGTCGTGGGGATACGGACGCATCTTTCGAGGATTTGAGAAACTCTTTGGACCGGATGTGTGACGGACGACAAGTCCCTGGAGACTGCCAAATTCATGGAGTGCCTCCAAGGGATCTGCAAGTCAACACACCGAATGGAGTGCCTCCAATATGCAGCTTACAGGAGCGTCGTGATCAGTACTTCGATCAGTACTTCGTTTGGGCCAAAAGCGAGGAACCAACGCCAACCTGGAGTATGCAGCTTTTAAGCACCGGCAGC

Full Affymetrix probeset data:

Annotations for 1633159_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720