Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633162_at:

>probe:Drosophila_2:1633162_at:690:663; Interrogation_Position=1244; Antisense; TACAACGCAAGTGGACAACGGTCGC
>probe:Drosophila_2:1633162_at:234:251; Interrogation_Position=1259; Antisense; CAACGGTCGCCGTAGTCATGTCCAT
>probe:Drosophila_2:1633162_at:396:485; Interrogation_Position=1270; Antisense; GTAGTCATGTCCATCGCATCCTTAG
>probe:Drosophila_2:1633162_at:514:43; Interrogation_Position=1282; Antisense; ATCGCATCCTTAGCTCTAAGCAGTT
>probe:Drosophila_2:1633162_at:169:329; Interrogation_Position=1301; Antisense; GCAGTTAGTTTGGTAGTGTCCTTTT
>probe:Drosophila_2:1633162_at:632:515; Interrogation_Position=1316; Antisense; GTGTCCTTTTTATGTAGGCTACATT
>probe:Drosophila_2:1633162_at:314:571; Interrogation_Position=1332; Antisense; GGCTACATTCGTTTTTATGTTTGGA
>probe:Drosophila_2:1633162_at:486:557; Interrogation_Position=1354; Antisense; GGACTAGGAACTTTGATACTCCTTA
>probe:Drosophila_2:1633162_at:482:173; Interrogation_Position=1433; Antisense; AAAGCGCTTATTTTGTACATGCATG
>probe:Drosophila_2:1633162_at:233:187; Interrogation_Position=1489; Antisense; AACAAACACCACAATGCGTAAGCAA
>probe:Drosophila_2:1633162_at:478:491; Interrogation_Position=1506; Antisense; GTAAGCAAACGAACCCATAAAGACA
>probe:Drosophila_2:1633162_at:709:217; Interrogation_Position=1676; Antisense; AAGTGCATTAAACCAACCGCCTTCG
>probe:Drosophila_2:1633162_at:340:313; Interrogation_Position=1694; Antisense; GCCTTCGTCGTCGTTTTTCTTTGCT
>probe:Drosophila_2:1633162_at:694:243; Interrogation_Position=1759; Antisense; AATTACGCTGTAGATTGGACTCAAG

Paste this into a BLAST search page for me
TACAACGCAAGTGGACAACGGTCGCCAACGGTCGCCGTAGTCATGTCCATGTAGTCATGTCCATCGCATCCTTAGATCGCATCCTTAGCTCTAAGCAGTTGCAGTTAGTTTGGTAGTGTCCTTTTGTGTCCTTTTTATGTAGGCTACATTGGCTACATTCGTTTTTATGTTTGGAGGACTAGGAACTTTGATACTCCTTAAAAGCGCTTATTTTGTACATGCATGAACAAACACCACAATGCGTAAGCAAGTAAGCAAACGAACCCATAAAGACAAAGTGCATTAAACCAACCGCCTTCGGCCTTCGTCGTCGTTTTTCTTTGCTAATTACGCTGTAGATTGGACTCAAG

Full Affymetrix probeset data:

Annotations for 1633162_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime