Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633165_at:

>probe:Drosophila_2:1633165_at:153:251; Interrogation_Position=123; Antisense; CAATGCATCGCTGGCCGTTGTGGTG
>probe:Drosophila_2:1633165_at:529:615; Interrogation_Position=14; Antisense; TGAATCCTGGCGAAATGCGGCCTTC
>probe:Drosophila_2:1633165_at:498:543; Interrogation_Position=147; Antisense; GGATCACGAGTATATGACGGTTCAT
>probe:Drosophila_2:1633165_at:160:327; Interrogation_Position=173; Antisense; GCGAGAATATATTGGCTCATTTCGA
>probe:Drosophila_2:1633165_at:642:421; Interrogation_Position=196; Antisense; GAGAAAATCCTGAGCGACGTAATAC
>probe:Drosophila_2:1633165_at:69:701; Interrogation_Position=293; Antisense; TTTTGGCTGCCATAACTGTTACGGA
>probe:Drosophila_2:1633165_at:66:719; Interrogation_Position=318; Antisense; TTGCGAGAATACATGGAACTTTTAC
>probe:Drosophila_2:1633165_at:532:379; Interrogation_Position=345; Antisense; GAACACTCAGGAAACTTCAATTCTA
>probe:Drosophila_2:1633165_at:661:233; Interrogation_Position=362; Antisense; CAATTCTACTGATCGCCATTACGGA
>probe:Drosophila_2:1633165_at:520:13; Interrogation_Position=379; Antisense; ATTACGGATTCCGACTGTCCCAGGC
>probe:Drosophila_2:1633165_at:674:571; Interrogation_Position=401; Antisense; GGCTGCCCCTAAATAGAGCTCTAAT
>probe:Drosophila_2:1633165_at:227:587; Interrogation_Position=60; Antisense; TGGACTGCAGCTCTCTATCCTGGTA
>probe:Drosophila_2:1633165_at:389:539; Interrogation_Position=81; Antisense; GGTACCCACTGAGGCCAATGACTTT
>probe:Drosophila_2:1633165_at:701:223; Interrogation_Position=97; Antisense; AATGACTTTTCGTCCTTCCTGAGCG

Paste this into a BLAST search page for me
CAATGCATCGCTGGCCGTTGTGGTGTGAATCCTGGCGAAATGCGGCCTTCGGATCACGAGTATATGACGGTTCATGCGAGAATATATTGGCTCATTTCGAGAGAAAATCCTGAGCGACGTAATACTTTTGGCTGCCATAACTGTTACGGATTGCGAGAATACATGGAACTTTTACGAACACTCAGGAAACTTCAATTCTACAATTCTACTGATCGCCATTACGGAATTACGGATTCCGACTGTCCCAGGCGGCTGCCCCTAAATAGAGCTCTAATTGGACTGCAGCTCTCTATCCTGGTAGGTACCCACTGAGGCCAATGACTTTAATGACTTTTCGTCCTTCCTGAGCG

Full Affymetrix probeset data:

Annotations for 1633165_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime