FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633166_at:

>probe:Drosophila_2:1633166_at:90:543; Interrogation_Position=1856; Antisense; GGATTACCCGTACAAGTGCCAGAAG
>probe:Drosophila_2:1633166_at:367:263; Interrogation_Position=1886; Antisense; CAGCGAGTTCGCTGATCGCAGCAAA
>probe:Drosophila_2:1633166_at:200:245; Interrogation_Position=1909; Antisense; AATTCCGCCAACATTCCAAGAAGGT
>probe:Drosophila_2:1633166_at:487:265; Interrogation_Position=1959; Antisense; CAGTTGGCTGAGATGTTCCGCGAGA
>probe:Drosophila_2:1633166_at:146:373; Interrogation_Position=1985; Antisense; GAAGGGCTACACCAATCGGCATGAT
>probe:Drosophila_2:1633166_at:649:427; Interrogation_Position=2037; Antisense; GAGATTCCAGGCCTCACGGAAGACT
>probe:Drosophila_2:1633166_at:709:375; Interrogation_Position=2055; Antisense; GAAGACTGTTTCACCGAGCTGGAGA
>probe:Drosophila_2:1633166_at:1:611; Interrogation_Position=2096; Antisense; TGACGCCATAACTACTGATCTCTTT
>probe:Drosophila_2:1633166_at:398:397; Interrogation_Position=2139; Antisense; GACAACCTGCTCAATTTGATACCTT
>probe:Drosophila_2:1633166_at:458:83; Interrogation_Position=2170; Antisense; AGGGCCACGATCAATCTACCTGCAT
>probe:Drosophila_2:1633166_at:116:197; Interrogation_Position=2211; Antisense; AACGGCACACATATTAGCTGACGAG
>probe:Drosophila_2:1633166_at:64:407; Interrogation_Position=2244; Antisense; GACTGTCTGCACTTTACAAATCGCC
>probe:Drosophila_2:1633166_at:451:387; Interrogation_Position=2311; Antisense; GAACAACTATTTTGCTCAACCGATT
>probe:Drosophila_2:1633166_at:66:75; Interrogation_Position=2416; Antisense; AGGACACACGCGTTTCTGAAGCGCA

Paste this into a BLAST search page for me
GGATTACCCGTACAAGTGCCAGAAGCAGCGAGTTCGCTGATCGCAGCAAAAATTCCGCCAACATTCCAAGAAGGTCAGTTGGCTGAGATGTTCCGCGAGAGAAGGGCTACACCAATCGGCATGATGAGATTCCAGGCCTCACGGAAGACTGAAGACTGTTTCACCGAGCTGGAGATGACGCCATAACTACTGATCTCTTTGACAACCTGCTCAATTTGATACCTTAGGGCCACGATCAATCTACCTGCATAACGGCACACATATTAGCTGACGAGGACTGTCTGCACTTTACAAATCGCCGAACAACTATTTTGCTCAACCGATTAGGACACACGCGTTTCTGAAGCGCA

Full Affymetrix probeset data:

Annotations for 1633166_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720