Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633167_s_at:

>probe:Drosophila_2:1633167_s_at:578:523; Interrogation_Position=1026; Antisense; GGGCTCCTGGCACAACAACGATTGG
>probe:Drosophila_2:1633167_s_at:411:279; Interrogation_Position=1053; Antisense; CTACTCGCTAACCTTCGTGGAGATG
>probe:Drosophila_2:1633167_s_at:371:319; Interrogation_Position=595; Antisense; GCCGAGAACTTCGATCGCGGTTGGA
>probe:Drosophila_2:1633167_s_at:601:663; Interrogation_Position=625; Antisense; TACAAGGATGGTTTCGGACGCGTGA
>probe:Drosophila_2:1633167_s_at:583:511; Interrogation_Position=653; Antisense; GTGAGTTTTTCATCGGCCTGGAGAA
>probe:Drosophila_2:1633167_s_at:639:393; Interrogation_Position=675; Antisense; GAAAGTGCACCTTATGACGCGGCAA
>probe:Drosophila_2:1633167_s_at:530:135; Interrogation_Position=699; Antisense; ACGACGCCACGAACTGTACATTAAG
>probe:Drosophila_2:1633167_s_at:34:399; Interrogation_Position=763; Antisense; GACAACTTCGAACTCGGCGGCGAGA
>probe:Drosophila_2:1633167_s_at:182:609; Interrogation_Position=798; Antisense; TGAGCTAAAGTCACTGGGCCGCTAC
>probe:Drosophila_2:1633167_s_at:696:55; Interrogation_Position=854; Antisense; ATGAGCGCCAAAAGTTCACCACCAA
>probe:Drosophila_2:1633167_s_at:71:199; Interrogation_Position=889; Antisense; AACGATGCCTATCGGTTCAACTGTG
>probe:Drosophila_2:1633167_s_at:678:195; Interrogation_Position=907; Antisense; AACTGTGCCGCCGACGAATATGGTG
>probe:Drosophila_2:1633167_s_at:567:333; Interrogation_Position=932; Antisense; GCTGGTGGTACTACGATTGCGCCAA
>probe:Drosophila_2:1633167_s_at:625:215; Interrogation_Position=973; Antisense; AAGTTCTACAAGGAGGGCCGCTCGC

Paste this into a BLAST search page for me
GGGCTCCTGGCACAACAACGATTGGCTACTCGCTAACCTTCGTGGAGATGGCCGAGAACTTCGATCGCGGTTGGATACAAGGATGGTTTCGGACGCGTGAGTGAGTTTTTCATCGGCCTGGAGAAGAAAGTGCACCTTATGACGCGGCAAACGACGCCACGAACTGTACATTAAGGACAACTTCGAACTCGGCGGCGAGATGAGCTAAAGTCACTGGGCCGCTACATGAGCGCCAAAAGTTCACCACCAAAACGATGCCTATCGGTTCAACTGTGAACTGTGCCGCCGACGAATATGGTGGCTGGTGGTACTACGATTGCGCCAAAAGTTCTACAAGGAGGGCCGCTCGC

Full Affymetrix probeset data:

Annotations for 1633167_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime